Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630233_at:

>probe:Drosophila_2:1630233_at:207:201; Interrogation_Position=389; Antisense; AACCTCAGCGGATACAATGTCACCC
>probe:Drosophila_2:1630233_at:221:469; Interrogation_Position=451; Antisense; GTTGCTTAGCTTTGTGAACTCCACC
>probe:Drosophila_2:1630233_at:707:129; Interrogation_Position=473; Antisense; ACCTATCTGGTTGGATGCACCTACA
>probe:Drosophila_2:1630233_at:618:699; Interrogation_Position=529; Antisense; TTTTATTCTGGGTAGGTCCACCTAT
>probe:Drosophila_2:1630233_at:17:495; Interrogation_Position=544; Antisense; GTCCACCTATACTCCGGAAGGCGTA
>probe:Drosophila_2:1630233_at:143:465; Interrogation_Position=571; Antisense; GATTGCCAACAATGATGCCTCCGTG
>probe:Drosophila_2:1630233_at:568:631; Interrogation_Position=590; Antisense; TCCGTGTCCTTCAGCAATTTCCAGA
>probe:Drosophila_2:1630233_at:137:189; Interrogation_Position=617; Antisense; AACACCTACGGCAATGTCACTCAGT
>probe:Drosophila_2:1630233_at:625:493; Interrogation_Position=632; Antisense; GTCACTCAGTTGGATTGCCGTGCCA
>probe:Drosophila_2:1630233_at:175:609; Interrogation_Position=681; Antisense; TGACCCTGATATCTGGCTTCCTTGC
>probe:Drosophila_2:1630233_at:170:723; Interrogation_Position=702; Antisense; TTGCCTTTGCCCTTTTGCTGATCAA
>probe:Drosophila_2:1630233_at:443:99; Interrogation_Position=740; Antisense; AGATGTATCCAATGGCTGCTTTGCC
>probe:Drosophila_2:1630233_at:599:279; Interrogation_Position=755; Antisense; CTGCTTTGCCTAGCCACCATAAATG
>probe:Drosophila_2:1630233_at:179:707; Interrogation_Position=851; Antisense; TTGACTTTAAACACCGCACTCTGAA

Paste this into a BLAST search page for me
AACCTCAGCGGATACAATGTCACCCGTTGCTTAGCTTTGTGAACTCCACCACCTATCTGGTTGGATGCACCTACATTTTATTCTGGGTAGGTCCACCTATGTCCACCTATACTCCGGAAGGCGTAGATTGCCAACAATGATGCCTCCGTGTCCGTGTCCTTCAGCAATTTCCAGAAACACCTACGGCAATGTCACTCAGTGTCACTCAGTTGGATTGCCGTGCCATGACCCTGATATCTGGCTTCCTTGCTTGCCTTTGCCCTTTTGCTGATCAAAGATGTATCCAATGGCTGCTTTGCCCTGCTTTGCCTAGCCACCATAAATGTTGACTTTAAACACCGCACTCTGAA

Full Affymetrix probeset data:

Annotations for 1630233_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime