Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630236_s_at:

>probe:Drosophila_2:1630236_s_at:251:461; Interrogation_Position=1012; Antisense; GATTTCTATTGTGACTGTTCCCTGT
>probe:Drosophila_2:1630236_s_at:193:407; Interrogation_Position=1024; Antisense; GACTGTTCCCTGTTCTATGCAAATA
>probe:Drosophila_2:1630236_s_at:247:187; Interrogation_Position=533; Antisense; AACAACATGATGCTGGCCATCTCGA
>probe:Drosophila_2:1630236_s_at:261:293; Interrogation_Position=555; Antisense; CGATGATCGGTGTTTCGGAGGCCAT
>probe:Drosophila_2:1630236_s_at:665:447; Interrogation_Position=605; Antisense; GATGCCAATGTCTTCGCCGAGATCA
>probe:Drosophila_2:1630236_s_at:656:335; Interrogation_Position=648; Antisense; GCTGCTGGGCCTCGGAGATCTACAA
>probe:Drosophila_2:1630236_s_at:351:333; Interrogation_Position=802; Antisense; GCTGGGATCTCTGGCGCACAAGGTC
>probe:Drosophila_2:1630236_s_at:574:223; Interrogation_Position=821; Antisense; AAGGTCTACCAGTCGCTGTGCGATA
>probe:Drosophila_2:1630236_s_at:102:591; Interrogation_Position=852; Antisense; TGGGCAACAAGGACTTCTCCGTGGT
>probe:Drosophila_2:1630236_s_at:375:643; Interrogation_Position=867; Antisense; TCTCCGTGGTGTACGACCTGATGAA
>probe:Drosophila_2:1630236_s_at:558:471; Interrogation_Position=901; Antisense; GTTCAGCGTTTAGGTTACTCACAGA
>probe:Drosophila_2:1630236_s_at:345:265; Interrogation_Position=922; Antisense; CAGACTACAGGTTGTGGTGGCCACA
>probe:Drosophila_2:1630236_s_at:176:153; Interrogation_Position=961; Antisense; ACATCCAAACCAGTCCTGCATTTAA
>probe:Drosophila_2:1630236_s_at:335:277; Interrogation_Position=994; Antisense; CTAAGTTCCCTCTATTTCGATTTCT

Paste this into a BLAST search page for me
GATTTCTATTGTGACTGTTCCCTGTGACTGTTCCCTGTTCTATGCAAATAAACAACATGATGCTGGCCATCTCGACGATGATCGGTGTTTCGGAGGCCATGATGCCAATGTCTTCGCCGAGATCAGCTGCTGGGCCTCGGAGATCTACAAGCTGGGATCTCTGGCGCACAAGGTCAAGGTCTACCAGTCGCTGTGCGATATGGGCAACAAGGACTTCTCCGTGGTTCTCCGTGGTGTACGACCTGATGAAGTTCAGCGTTTAGGTTACTCACAGACAGACTACAGGTTGTGGTGGCCACAACATCCAAACCAGTCCTGCATTTAACTAAGTTCCCTCTATTTCGATTTCT

Full Affymetrix probeset data:

Annotations for 1630236_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime