Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630238_at:

>probe:Drosophila_2:1630238_at:298:443; Interrogation_Position=125; Antisense; GATGTCCAAGCCGATGGCTTCGTAA
>probe:Drosophila_2:1630238_at:92:571; Interrogation_Position=140; Antisense; GGCTTCGTAAGCAAGTTGGTCCTGG
>probe:Drosophila_2:1630238_at:68:729; Interrogation_Position=155; Antisense; TTGGTCCTGGACAACGGTTCCGCTG
>probe:Drosophila_2:1630238_at:605:641; Interrogation_Position=182; Antisense; TCTGCTACCGGAGATGTCCACGGAA
>probe:Drosophila_2:1630238_at:266:505; Interrogation_Position=197; Antisense; GTCCACGGAAACATCGACGGAGTTT
>probe:Drosophila_2:1630238_at:326:137; Interrogation_Position=249; Antisense; ACGTCCGTGTGAGCTACAAGGCCGA
>probe:Drosophila_2:1630238_at:343:127; Interrogation_Position=395; Antisense; ACCAGGACCCACATTCGAATCGGAG
>probe:Drosophila_2:1630238_at:470:435; Interrogation_Position=417; Antisense; GAGGTGCAACTCCAAAGACCTTGCC
>probe:Drosophila_2:1630238_at:260:665; Interrogation_Position=502; Antisense; TAAATTCGATACTCTTTGGCAACAA
>probe:Drosophila_2:1630238_at:180:65; Interrogation_Position=539; Antisense; ATGGTCTTAATTTCCCTGACGGCAG
>probe:Drosophila_2:1630238_at:61:551; Interrogation_Position=566; Antisense; GGAGTTACCTTGTTTATGGCTGATT
>probe:Drosophila_2:1630238_at:516:317; Interrogation_Position=598; Antisense; GCCGAGGGAACAAACGCTGCTTCAG
>probe:Drosophila_2:1630238_at:409:29; Interrogation_Position=626; Antisense; ATCACGAACTGTCTGGATGTTACGT
>probe:Drosophila_2:1630238_at:27:453; Interrogation_Position=655; Antisense; GATCTTAGCCAATAGTAACCTGTTT

Paste this into a BLAST search page for me
GATGTCCAAGCCGATGGCTTCGTAAGGCTTCGTAAGCAAGTTGGTCCTGGTTGGTCCTGGACAACGGTTCCGCTGTCTGCTACCGGAGATGTCCACGGAAGTCCACGGAAACATCGACGGAGTTTACGTCCGTGTGAGCTACAAGGCCGAACCAGGACCCACATTCGAATCGGAGGAGGTGCAACTCCAAAGACCTTGCCTAAATTCGATACTCTTTGGCAACAAATGGTCTTAATTTCCCTGACGGCAGGGAGTTACCTTGTTTATGGCTGATTGCCGAGGGAACAAACGCTGCTTCAGATCACGAACTGTCTGGATGTTACGTGATCTTAGCCAATAGTAACCTGTTT

Full Affymetrix probeset data:

Annotations for 1630238_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime