FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630239_at:

>probe:Drosophila_2:1630239_at:556:347; Interrogation_Position=1035; Antisense; GCATGCGATTACCACATTGACCAAT
>probe:Drosophila_2:1630239_at:380:7; Interrogation_Position=1050; Antisense; ATTGACCAATGCCTGTTTCGAATCC
>probe:Drosophila_2:1630239_at:246:479; Interrogation_Position=1064; Antisense; GTTTCGAATCCTCCAACATGATGGT
>probe:Drosophila_2:1630239_at:511:651; Interrogation_Position=1088; Antisense; TCAAGTGTGATCCTCGTGCGGGCAA
>probe:Drosophila_2:1630239_at:720:11; Interrogation_Position=1113; Antisense; ATTCATGGCCTGTTGCATGCTTTAC
>probe:Drosophila_2:1630239_at:528:223; Interrogation_Position=1156; Antisense; AAGGATGTAAATGCCGCTGTCTCGG
>probe:Drosophila_2:1630239_at:43:87; Interrogation_Position=1187; Antisense; AGTCCAAGCGGCACATTCAATTCGT
>probe:Drosophila_2:1630239_at:443:143; Interrogation_Position=1214; Antisense; ACTGGTGTCCCACTGGTTTCAAAAT
>probe:Drosophila_2:1630239_at:108:347; Interrogation_Position=1241; Antisense; GCATCAACTACGAGAAGCCAGCCTT
>probe:Drosophila_2:1630239_at:119:203; Interrogation_Position=1255; Antisense; AAGCCAGCCTTTGTGCCGGATGGAG
>probe:Drosophila_2:1630239_at:493:249; Interrogation_Position=1347; Antisense; CAATCTCTCCTACAAGTTCGATCTG
>probe:Drosophila_2:1630239_at:536:637; Interrogation_Position=1368; Antisense; TCTGATGTTCAAGAAGCGGGCCTTC
>probe:Drosophila_2:1630239_at:593:149; Interrogation_Position=1520; Antisense; ACTTCGATGAGTTCTAAGCCCACAT
>probe:Drosophila_2:1630239_at:144:237; Interrogation_Position=1551; Antisense; AATCCCAGCCAGACTTCAGTCATTA

Paste this into a BLAST search page for me
GCATGCGATTACCACATTGACCAATATTGACCAATGCCTGTTTCGAATCCGTTTCGAATCCTCCAACATGATGGTTCAAGTGTGATCCTCGTGCGGGCAAATTCATGGCCTGTTGCATGCTTTACAAGGATGTAAATGCCGCTGTCTCGGAGTCCAAGCGGCACATTCAATTCGTACTGGTGTCCCACTGGTTTCAAAATGCATCAACTACGAGAAGCCAGCCTTAAGCCAGCCTTTGTGCCGGATGGAGCAATCTCTCCTACAAGTTCGATCTGTCTGATGTTCAAGAAGCGGGCCTTCACTTCGATGAGTTCTAAGCCCACATAATCCCAGCCAGACTTCAGTCATTA

Full Affymetrix probeset data:

Annotations for 1630239_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720