FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630241_at:

>probe:Drosophila_2:1630241_at:141:713; Interrogation_Position=362; Antisense; TTCATCCCAAGTATCGCACTCTGAA
>probe:Drosophila_2:1630241_at:211:139; Interrogation_Position=395; Antisense; ACGATGCGGCAATTCTGATCCTGGA
>probe:Drosophila_2:1630241_at:545:199; Interrogation_Position=436; Antisense; AACGACGCCGTGCAGCCGATTGAGT
>probe:Drosophila_2:1630241_at:721:451; Interrogation_Position=478; Antisense; GATCATGATACACCCGTTACCGTGA
>probe:Drosophila_2:1630241_at:681:139; Interrogation_Position=542; Antisense; ACGTCCTGCAGGAGGTCAGCGTTAA
>probe:Drosophila_2:1630241_at:58:519; Interrogation_Position=568; Antisense; GTGGTGGACAACTCGAACTGCAAGA
>probe:Drosophila_2:1630241_at:449:211; Interrogation_Position=589; Antisense; AAGAACGCCTATTCCATTATGCTGA
>probe:Drosophila_2:1630241_at:204:89; Interrogation_Position=616; Antisense; AGTCGTATGCTTTGCGCCGGAGTCA
>probe:Drosophila_2:1630241_at:424:591; Interrogation_Position=686; Antisense; TGGTCTACAACAACACACTCCTGGG
>probe:Drosophila_2:1630241_at:527:105; Interrogation_Position=743; Antisense; AGAAATATCCCGGAGTCTATTGCTC
>probe:Drosophila_2:1630241_at:303:291; Interrogation_Position=768; Antisense; CGTACCGGATGTTCTCGATTGGCTG
>probe:Drosophila_2:1630241_at:162:517; Interrogation_Position=818; Antisense; GTGTGGGCAAAATCGACTTTCTGTA
>probe:Drosophila_2:1630241_at:369:177; Interrogation_Position=869; Antisense; AAACGTCTTGTAACTAGCCTCAATC
>probe:Drosophila_2:1630241_at:659:123; Interrogation_Position=884; Antisense; AGCCTCAATCAACTCAAAACCTTTT

Paste this into a BLAST search page for me
TTCATCCCAAGTATCGCACTCTGAAACGATGCGGCAATTCTGATCCTGGAAACGACGCCGTGCAGCCGATTGAGTGATCATGATACACCCGTTACCGTGAACGTCCTGCAGGAGGTCAGCGTTAAGTGGTGGACAACTCGAACTGCAAGAAAGAACGCCTATTCCATTATGCTGAAGTCGTATGCTTTGCGCCGGAGTCATGGTCTACAACAACACACTCCTGGGAGAAATATCCCGGAGTCTATTGCTCCGTACCGGATGTTCTCGATTGGCTGGTGTGGGCAAAATCGACTTTCTGTAAAACGTCTTGTAACTAGCCTCAATCAGCCTCAATCAACTCAAAACCTTTT

Full Affymetrix probeset data:

Annotations for 1630241_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720