Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630242_at:

>probe:Drosophila_2:1630242_at:183:107; Interrogation_Position=3513; Antisense; AGAAGAAACGCCAGGACATCCCACT
>probe:Drosophila_2:1630242_at:728:93; Interrogation_Position=3545; Antisense; AGTTCCGTGAATTCAGTGCCCAGCA
>probe:Drosophila_2:1630242_at:432:355; Interrogation_Position=3567; Antisense; GCACTTCTACTAACTTGATTCCCAA
>probe:Drosophila_2:1630242_at:684:467; Interrogation_Position=3613; Antisense; GTTGACACAACATTCATCCAGAAAT
>probe:Drosophila_2:1630242_at:452:473; Interrogation_Position=3661; Antisense; GTATACTGGTCAAAACTACTCCGGA
>probe:Drosophila_2:1630242_at:455:147; Interrogation_Position=3675; Antisense; ACTACTCCGGAAATGTGGCTCGATT
>probe:Drosophila_2:1630242_at:35:661; Interrogation_Position=3727; Antisense; TAACCCCTTCACTTCGAACGCGTAT
>probe:Drosophila_2:1630242_at:276:381; Interrogation_Position=3742; Antisense; GAACGCGTATCCGACTGATCGTGGA
>probe:Drosophila_2:1630242_at:199:247; Interrogation_Position=3795; Antisense; AATTCGGCTCTAAACTACCGGCAAT
>probe:Drosophila_2:1630242_at:488:565; Interrogation_Position=3814; Antisense; GGCAATCAACCCAAGCAGCGTTTTG
>probe:Drosophila_2:1630242_at:196:199; Interrogation_Position=3842; Antisense; AACGATCTGACAACGTCGTCACTCT
>probe:Drosophila_2:1630242_at:398:651; Interrogation_Position=3860; Antisense; TCACTCTTCAACTTCAACACCAATT
>probe:Drosophila_2:1630242_at:110:189; Interrogation_Position=3875; Antisense; AACACCAATTTGAACCCATCTTATA
>probe:Drosophila_2:1630242_at:625:165; Interrogation_Position=4059; Antisense; AAATCGATTTTATAACGGCAGCCAA

Paste this into a BLAST search page for me
AGAAGAAACGCCAGGACATCCCACTAGTTCCGTGAATTCAGTGCCCAGCAGCACTTCTACTAACTTGATTCCCAAGTTGACACAACATTCATCCAGAAATGTATACTGGTCAAAACTACTCCGGAACTACTCCGGAAATGTGGCTCGATTTAACCCCTTCACTTCGAACGCGTATGAACGCGTATCCGACTGATCGTGGAAATTCGGCTCTAAACTACCGGCAATGGCAATCAACCCAAGCAGCGTTTTGAACGATCTGACAACGTCGTCACTCTTCACTCTTCAACTTCAACACCAATTAACACCAATTTGAACCCATCTTATAAAATCGATTTTATAACGGCAGCCAA

Full Affymetrix probeset data:

Annotations for 1630242_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime