FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630243_at:

>probe:Drosophila_2:1630243_at:37:397; Interrogation_Position=195; Antisense; GACAGCGGGCAACAGGCATACTCGC
>probe:Drosophila_2:1630243_at:152:669; Interrogation_Position=213; Antisense; TACTCGCTACCGCAGCTATAAGTTT
>probe:Drosophila_2:1630243_at:271:437; Interrogation_Position=283; Antisense; GAGGATCCTCAACCCATTGAACAGA
>probe:Drosophila_2:1630243_at:600:373; Interrogation_Position=309; Antisense; GAAGTTGCCACAGCAGTTGGTCCAG
>probe:Drosophila_2:1630243_at:638:535; Interrogation_Position=327; Antisense; GGTCCAGCAGACCAACCAGACGATA
>probe:Drosophila_2:1630243_at:243:255; Interrogation_Position=395; Antisense; CAACTCGCAAGGGACTGGGCATGGT
>probe:Drosophila_2:1630243_at:56:519; Interrogation_Position=449; Antisense; GTGGTCTGGGCCTGAATCTCAAAGC
>probe:Drosophila_2:1630243_at:640:297; Interrogation_Position=505; Antisense; CGCACGGTGCGCATGTATAATTTGT
>probe:Drosophila_2:1630243_at:332:191; Interrogation_Position=547; Antisense; AACTACTATCGGCACGCCTTGGAGA
>probe:Drosophila_2:1630243_at:644:219; Interrogation_Position=598; Antisense; AAGTGCAGCAATGCGCGCTCCGAGA
>probe:Drosophila_2:1630243_at:448:425; Interrogation_Position=619; Antisense; GAGAGCCATAAGTCCAGCTCCAGTT
>probe:Drosophila_2:1630243_at:60:561; Interrogation_Position=648; Antisense; GGAAAGCCTCCAGAAGATACCCTCG
>probe:Drosophila_2:1630243_at:638:21; Interrogation_Position=676; Antisense; ATAGAGTTCCTCACCTGCTTTCTGG
>probe:Drosophila_2:1630243_at:225:169; Interrogation_Position=726; Antisense; AAATGTGCCAGTTGGGCAGCCGCTG

Paste this into a BLAST search page for me
GACAGCGGGCAACAGGCATACTCGCTACTCGCTACCGCAGCTATAAGTTTGAGGATCCTCAACCCATTGAACAGAGAAGTTGCCACAGCAGTTGGTCCAGGGTCCAGCAGACCAACCAGACGATACAACTCGCAAGGGACTGGGCATGGTGTGGTCTGGGCCTGAATCTCAAAGCCGCACGGTGCGCATGTATAATTTGTAACTACTATCGGCACGCCTTGGAGAAAGTGCAGCAATGCGCGCTCCGAGAGAGAGCCATAAGTCCAGCTCCAGTTGGAAAGCCTCCAGAAGATACCCTCGATAGAGTTCCTCACCTGCTTTCTGGAAATGTGCCAGTTGGGCAGCCGCTG

Full Affymetrix probeset data:

Annotations for 1630243_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720