Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630244_s_at:

>probe:Drosophila_2:1630244_s_at:221:283; Interrogation_Position=127; Antisense; CTGATTGCAGTCACCAACGAGATTG
>probe:Drosophila_2:1630244_s_at:552:227; Interrogation_Position=157; Antisense; AATGTGGGCACGATTCACGACCCGG
>probe:Drosophila_2:1630244_s_at:85:651; Interrogation_Position=171; Antisense; TCACGACCCGGAAAGCCTTGACAAG
>probe:Drosophila_2:1630244_s_at:596:73; Interrogation_Position=203; Antisense; AGGACATGTTGTGGGACCTTCTCAC
>probe:Drosophila_2:1630244_s_at:453:413; Interrogation_Position=217; Antisense; GACCTTCTCACCGTCAACGTGGGAT
>probe:Drosophila_2:1630244_s_at:647:107; Interrogation_Position=297; Antisense; AGCAATTGTTAACCTCGGATCCTCC
>probe:Drosophila_2:1630244_s_at:605:43; Interrogation_Position=338; Antisense; ATCCCAATTTGACTGCTTATGCGGC
>probe:Drosophila_2:1630244_s_at:628:51; Interrogation_Position=356; Antisense; ATGCGGCTACCAAGAAGTTCGTTAC
>probe:Drosophila_2:1630244_s_at:339:79; Interrogation_Position=407; Antisense; AGGTGGCCGAACACAATATCCATGT
>probe:Drosophila_2:1630244_s_at:388:509; Interrogation_Position=430; Antisense; GTGCAGTTGGTTATGCCAGCCTTTG
>probe:Drosophila_2:1630244_s_at:364:69; Interrogation_Position=490; Antisense; AGGCAAGGAGGACTGCTTTTCCCCA
>probe:Drosophila_2:1630244_s_at:365:503; Interrogation_Position=534; Antisense; GTCCGCAGTCTTTACACTGGGAAAG
>probe:Drosophila_2:1630244_s_at:27:139; Interrogation_Position=572; Antisense; ACGGTTTCTGGGTTCATGGATTACA
>probe:Drosophila_2:1630244_s_at:136:637; Interrogation_Position=671; Antisense; TCGAGGCCATGGAGCACAGACTGAA

Paste this into a BLAST search page for me
CTGATTGCAGTCACCAACGAGATTGAATGTGGGCACGATTCACGACCCGGTCACGACCCGGAAAGCCTTGACAAGAGGACATGTTGTGGGACCTTCTCACGACCTTCTCACCGTCAACGTGGGATAGCAATTGTTAACCTCGGATCCTCCATCCCAATTTGACTGCTTATGCGGCATGCGGCTACCAAGAAGTTCGTTACAGGTGGCCGAACACAATATCCATGTGTGCAGTTGGTTATGCCAGCCTTTGAGGCAAGGAGGACTGCTTTTCCCCAGTCCGCAGTCTTTACACTGGGAAAGACGGTTTCTGGGTTCATGGATTACATCGAGGCCATGGAGCACAGACTGAA

Full Affymetrix probeset data:

Annotations for 1630244_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime