FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630246_at:

>probe:Drosophila_2:1630246_at:41:605; Interrogation_Position=110; Antisense; TGATAGACCGCAACAAGACCGGATT
>probe:Drosophila_2:1630246_at:87:161; Interrogation_Position=122; Antisense; ACAAGACCGGATTCATGGGCACCTT
>probe:Drosophila_2:1630246_at:585:103; Interrogation_Position=125; Antisense; AGACCGGATTCATGGGCACCTTCTG
>probe:Drosophila_2:1630246_at:661:461; Interrogation_Position=131; Antisense; GATTCATGGGCACCTTCTGGAAGCT
>probe:Drosophila_2:1630246_at:481:63; Interrogation_Position=136; Antisense; ATGGGCACCTTCTGGAAGCTGGCAA
>probe:Drosophila_2:1630246_at:427:261; Interrogation_Position=141; Antisense; CACCTTCTGGAAGCTGGCAAGGATT
>probe:Drosophila_2:1630246_at:520:217; Interrogation_Position=175; Antisense; AAGTCGCCGTGGGTAGGAGCCGCCT
>probe:Drosophila_2:1630246_at:343:605; Interrogation_Position=203; Antisense; TGATCATGGCCTTCACCGTTCTCTT
>probe:Drosophila_2:1630246_at:537:275; Interrogation_Position=213; Antisense; CTTCACCGTTCTCTTTTGGAGCTGA
>probe:Drosophila_2:1630246_at:353:603; Interrogation_Position=29; Antisense; TGTTCAACTTCCACAGCCTGCTGTC
>probe:Drosophila_2:1630246_at:1:157; Interrogation_Position=41; Antisense; ACAGCCTGCTGTCGGTCATCCTGCT
>probe:Drosophila_2:1630246_at:667:47; Interrogation_Position=58; Antisense; ATCCTGCTGCTGATCTGCACCTGTG
>probe:Drosophila_2:1630246_at:558:333; Interrogation_Position=66; Antisense; GCTGATCTGCACCTGTGCCTACCTG
>probe:Drosophila_2:1630246_at:608:643; Interrogation_Position=98; Antisense; TCTTCCCCAGCTTGATAGACCGCAA

Paste this into a BLAST search page for me
TGATAGACCGCAACAAGACCGGATTACAAGACCGGATTCATGGGCACCTTAGACCGGATTCATGGGCACCTTCTGGATTCATGGGCACCTTCTGGAAGCTATGGGCACCTTCTGGAAGCTGGCAACACCTTCTGGAAGCTGGCAAGGATTAAGTCGCCGTGGGTAGGAGCCGCCTTGATCATGGCCTTCACCGTTCTCTTCTTCACCGTTCTCTTTTGGAGCTGATGTTCAACTTCCACAGCCTGCTGTCACAGCCTGCTGTCGGTCATCCTGCTATCCTGCTGCTGATCTGCACCTGTGGCTGATCTGCACCTGTGCCTACCTGTCTTCCCCAGCTTGATAGACCGCAA

Full Affymetrix probeset data:

Annotations for 1630246_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720