Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630247_at:

>probe:Drosophila_2:1630247_at:694:241; Interrogation_Position=7801; Antisense; AATATACGCTTCCTCATTAACAAGG
>probe:Drosophila_2:1630247_at:512:73; Interrogation_Position=7823; Antisense; AGGAAGTCGCAAAGGCACCTCACGA
>probe:Drosophila_2:1630247_at:692:567; Interrogation_Position=7836; Antisense; GGCACCTCACGACATCAGCATAAGA
>probe:Drosophila_2:1630247_at:386:697; Interrogation_Position=7870; Antisense; TTTACGCTCATAGAGGCGCTGTCCA
>probe:Drosophila_2:1630247_at:386:131; Interrogation_Position=7894; Antisense; ACGCTACTCAGTGTGGAGTCCGTGA
>probe:Drosophila_2:1630247_at:665:627; Interrogation_Position=7940; Antisense; TCCAGGCGCTGGTTCGTGAAATGTC
>probe:Drosophila_2:1630247_at:476:111; Interrogation_Position=8000; Antisense; AGCAAGCTCTCCGTGTAGGCAGTCG
>probe:Drosophila_2:1630247_at:574:679; Interrogation_Position=8015; Antisense; TAGGCAGTCGCCTGAGGAAGCGCAT
>probe:Drosophila_2:1630247_at:345:395; Interrogation_Position=8066; Antisense; GAAATGCGGTGCAAACCAAGCTGAT
>probe:Drosophila_2:1630247_at:478:329; Interrogation_Position=8106; Antisense; GCGTCGCAAGGTTGTGGCTCAAGAA
>probe:Drosophila_2:1630247_at:164:95; Interrogation_Position=8132; Antisense; AGATTCACGATCCTGAACGGGCGGC
>probe:Drosophila_2:1630247_at:453:295; Interrogation_Position=8195; Antisense; CGAAGCGTCTAAAGGCGGCTGTTGT
>probe:Drosophila_2:1630247_at:54:729; Interrogation_Position=8216; Antisense; TTGTGCGTGGCAAAGCGCCGGACAT
>probe:Drosophila_2:1630247_at:168:93; Interrogation_Position=8295; Antisense; AGTTAGTCGGTCTGCTTTAGTATAA

Paste this into a BLAST search page for me
AATATACGCTTCCTCATTAACAAGGAGGAAGTCGCAAAGGCACCTCACGAGGCACCTCACGACATCAGCATAAGATTTACGCTCATAGAGGCGCTGTCCAACGCTACTCAGTGTGGAGTCCGTGATCCAGGCGCTGGTTCGTGAAATGTCAGCAAGCTCTCCGTGTAGGCAGTCGTAGGCAGTCGCCTGAGGAAGCGCATGAAATGCGGTGCAAACCAAGCTGATGCGTCGCAAGGTTGTGGCTCAAGAAAGATTCACGATCCTGAACGGGCGGCCGAAGCGTCTAAAGGCGGCTGTTGTTTGTGCGTGGCAAAGCGCCGGACATAGTTAGTCGGTCTGCTTTAGTATAA

Full Affymetrix probeset data:

Annotations for 1630247_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime