Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630248_at:

>probe:Drosophila_2:1630248_at:147:283; Interrogation_Position=1339; Antisense; CTGCCCGGCAGCGAAAAGTGGAATC
>probe:Drosophila_2:1630248_at:328:221; Interrogation_Position=1354; Antisense; AAGTGGAATCGCGTGGGCCACCTGC
>probe:Drosophila_2:1630248_at:449:337; Interrogation_Position=1382; Antisense; GCTCCATACTCGTCAACTGTGGCGA
>probe:Drosophila_2:1630248_at:670:557; Interrogation_Position=1421; Antisense; GGACACAGGGACGATATCCGGCATT
>probe:Drosophila_2:1630248_at:523:47; Interrogation_Position=1436; Antisense; ATCCGGCATTGCAACATCGCGTGAT
>probe:Drosophila_2:1630248_at:137:153; Interrogation_Position=1449; Antisense; ACATCGCGTGATAATACCGGAGCAG
>probe:Drosophila_2:1630248_at:142:347; Interrogation_Position=1470; Antisense; GCAGGAAACTATTCGGGCTCGTGGC
>probe:Drosophila_2:1630248_at:617:675; Interrogation_Position=1505; Antisense; TAGCGTTCTTCTGCCATCCGGACAA
>probe:Drosophila_2:1630248_at:436:235; Interrogation_Position=1561; Antisense; AATCCAGATGCCGTCCAGGACAAGG
>probe:Drosophila_2:1630248_at:703:159; Interrogation_Position=1580; Antisense; ACAAGGCGTGTCTCAAGCAGCGCAA
>probe:Drosophila_2:1630248_at:166:361; Interrogation_Position=1601; Antisense; GCAAGAAGTCCTTCAAGGCGGCGAA
>probe:Drosophila_2:1630248_at:527:391; Interrogation_Position=1627; Antisense; GAAAGAGTCTACAATGCCTATCAGT
>probe:Drosophila_2:1630248_at:727:25; Interrogation_Position=1721; Antisense; ATAGTCGGTCGAGCCATCCATCGCA
>probe:Drosophila_2:1630248_at:579:43; Interrogation_Position=1740; Antisense; ATCGCATCTCTACCTAAGCTGGGAT

Paste this into a BLAST search page for me
CTGCCCGGCAGCGAAAAGTGGAATCAAGTGGAATCGCGTGGGCCACCTGCGCTCCATACTCGTCAACTGTGGCGAGGACACAGGGACGATATCCGGCATTATCCGGCATTGCAACATCGCGTGATACATCGCGTGATAATACCGGAGCAGGCAGGAAACTATTCGGGCTCGTGGCTAGCGTTCTTCTGCCATCCGGACAAAATCCAGATGCCGTCCAGGACAAGGACAAGGCGTGTCTCAAGCAGCGCAAGCAAGAAGTCCTTCAAGGCGGCGAAGAAAGAGTCTACAATGCCTATCAGTATAGTCGGTCGAGCCATCCATCGCAATCGCATCTCTACCTAAGCTGGGAT

Full Affymetrix probeset data:

Annotations for 1630248_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime