FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630249_at:

>probe:Drosophila_2:1630249_at:206:335; Interrogation_Position=1752; Antisense; GCTGCCTGGGAATGGTCAACGTCGT
>probe:Drosophila_2:1630249_at:327:221; Interrogation_Position=1791; Antisense; AAGTGGTTCCACTGGCTACGAGCAC
>probe:Drosophila_2:1630249_at:371:155; Interrogation_Position=1814; Antisense; ACAGCGGCGGTTTCGATGGGTCCTT
>probe:Drosophila_2:1630249_at:184:173; Interrogation_Position=1885; Antisense; AAAGAGCGTTCTCCTGGGCAGTGTA
>probe:Drosophila_2:1630249_at:304:569; Interrogation_Position=1901; Antisense; GGCAGTGTAGTGTCCTTTTTGGTAT
>probe:Drosophila_2:1630249_at:51:483; Interrogation_Position=1938; Antisense; GTATCAAGGCGCAGTTGGCTCAAAT
>probe:Drosophila_2:1630249_at:654:423; Interrogation_Position=1968; Antisense; GAGAGATTCGTTATCCCAAACTTCC
>probe:Drosophila_2:1630249_at:708:37; Interrogation_Position=2078; Antisense; ATCTATCACTTGTCATTCCTGTGGT
>probe:Drosophila_2:1630249_at:606:329; Interrogation_Position=2115; Antisense; GCGGGTTTATTTGCACTGTGGTTTC
>probe:Drosophila_2:1630249_at:573:717; Interrogation_Position=2153; Antisense; TTCGTTTTCGGTTGGGAGGATCTCA
>probe:Drosophila_2:1630249_at:110:229; Interrogation_Position=2182; Antisense; AATGGATCCAGCCTTGATTACGCCC
>probe:Drosophila_2:1630249_at:3:485; Interrogation_Position=2208; Antisense; GTATGCGGCGTTTTTTGCCCAATAA
>probe:Drosophila_2:1630249_at:290:349; Interrogation_Position=2254; Antisense; GCAGGATCTCTTTAAGCGCAAGGAC
>probe:Drosophila_2:1630249_at:539:179; Interrogation_Position=2309; Antisense; AAACATGTACTCTCTGTTCTGCAAA

Paste this into a BLAST search page for me
GCTGCCTGGGAATGGTCAACGTCGTAAGTGGTTCCACTGGCTACGAGCACACAGCGGCGGTTTCGATGGGTCCTTAAAGAGCGTTCTCCTGGGCAGTGTAGGCAGTGTAGTGTCCTTTTTGGTATGTATCAAGGCGCAGTTGGCTCAAATGAGAGATTCGTTATCCCAAACTTCCATCTATCACTTGTCATTCCTGTGGTGCGGGTTTATTTGCACTGTGGTTTCTTCGTTTTCGGTTGGGAGGATCTCAAATGGATCCAGCCTTGATTACGCCCGTATGCGGCGTTTTTTGCCCAATAAGCAGGATCTCTTTAAGCGCAAGGACAAACATGTACTCTCTGTTCTGCAAA

Full Affymetrix probeset data:

Annotations for 1630249_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720