FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630251_at:

>probe:Drosophila_2:1630251_at:102:367; Interrogation_Position=394; Antisense; GAATCAGGTGGACTTTCTGCGCCAT
>probe:Drosophila_2:1630251_at:364:63; Interrogation_Position=417; Antisense; ATGGATCCCGGGACATTAGACCCAT
>probe:Drosophila_2:1630251_at:147:489; Interrogation_Position=496; Antisense; GTACGACTTTGCCAATCGGCGCTAT
>probe:Drosophila_2:1630251_at:293:595; Interrogation_Position=552; Antisense; TGGGCTTCACCATCACTGAGGAGCT
>probe:Drosophila_2:1630251_at:499:417; Interrogation_Position=602; Antisense; GAGCTGGACATCTTGAGGGCCATTC
>probe:Drosophila_2:1630251_at:333:523; Interrogation_Position=618; Antisense; GGGCCATTCATGATCACGACTGCAA
>probe:Drosophila_2:1630251_at:274:151; Interrogation_Position=675; Antisense; ACATTAAGGACTGCCAGCGCTGGAT
>probe:Drosophila_2:1630251_at:312:383; Interrogation_Position=752; Antisense; GAACGATCGCTTCAGGTGCTCAATG
>probe:Drosophila_2:1630251_at:472:619; Interrogation_Position=768; Antisense; TGCTCAATGTCTTCCACACGTATTT
>probe:Drosophila_2:1630251_at:377:367; Interrogation_Position=800; Antisense; GAATCGGCTGATAACTCATGGCACG
>probe:Drosophila_2:1630251_at:204:445; Interrogation_Position=824; Antisense; GATGAGGTGCAATACTCCCTTCGCA
>probe:Drosophila_2:1630251_at:34:623; Interrogation_Position=890; Antisense; TGCGGAGAGCCATTTGTCTTCGTAT
>probe:Drosophila_2:1630251_at:470:697; Interrogation_Position=914; Antisense; TTTAGTCGTTTTCGTGGCATCTGCA
>probe:Drosophila_2:1630251_at:520:39; Interrogation_Position=932; Antisense; ATCTGCACCTGCGATACCTATAAGA

Paste this into a BLAST search page for me
GAATCAGGTGGACTTTCTGCGCCATATGGATCCCGGGACATTAGACCCATGTACGACTTTGCCAATCGGCGCTATTGGGCTTCACCATCACTGAGGAGCTGAGCTGGACATCTTGAGGGCCATTCGGGCCATTCATGATCACGACTGCAAACATTAAGGACTGCCAGCGCTGGATGAACGATCGCTTCAGGTGCTCAATGTGCTCAATGTCTTCCACACGTATTTGAATCGGCTGATAACTCATGGCACGGATGAGGTGCAATACTCCCTTCGCATGCGGAGAGCCATTTGTCTTCGTATTTTAGTCGTTTTCGTGGCATCTGCAATCTGCACCTGCGATACCTATAAGA

Full Affymetrix probeset data:

Annotations for 1630251_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720