FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630252_at:

>probe:Drosophila_2:1630252_at:261:635; Interrogation_Position=114; Antisense; TCGCAAGAGCCCCAACTTGAAGAAA
>probe:Drosophila_2:1630252_at:573:357; Interrogation_Position=116; Antisense; GCAAGAGCCCCAACTTGAAGAAAAG
>probe:Drosophila_2:1630252_at:460:1; Interrogation_Position=139; Antisense; AGGCCCCGTTTCTATCGCCAAATTG
>probe:Drosophila_2:1630252_at:382:479; Interrogation_Position=146; Antisense; GTTTCTATCGCCAAATTGGCCTGGG
>probe:Drosophila_2:1630252_at:93:645; Interrogation_Position=149; Antisense; TCTATCGCCAAATTGGCCTGGGCTT
>probe:Drosophila_2:1630252_at:462:311; Interrogation_Position=155; Antisense; GCCAAATTGGCCTGGGCTTCCGCGC
>probe:Drosophila_2:1630252_at:188:3; Interrogation_Position=160; Antisense; ATTGGCCTGGGCTTCCGCGCTCCGG
>probe:Drosophila_2:1630252_at:297:67; Interrogation_Position=55; Antisense; ATGGCTGATCAGCAAACCGAACGCT
>probe:Drosophila_2:1630252_at:439:283; Interrogation_Position=59; Antisense; CTGATCAGCAAACCGAACGCTCGTT
>probe:Drosophila_2:1630252_at:168:175; Interrogation_Position=68; Antisense; AAACCGAACGCTCGTTCCGCAAGCA
>probe:Drosophila_2:1630252_at:22:635; Interrogation_Position=79; Antisense; TCGTTCCGCAAGCAACACGCGGTGG
>probe:Drosophila_2:1630252_at:641:209; Interrogation_Position=88; Antisense; AAGCAACACGCGGTGGTCGTTGTGC
>probe:Drosophila_2:1630252_at:449:255; Interrogation_Position=91; Antisense; CAACACGCGGTGGTCGTTGTGCGTC
>probe:Drosophila_2:1630252_at:185:289; Interrogation_Position=98; Antisense; CGGTGGTCGTTGTGCGTCGCAAGAG

Paste this into a BLAST search page for me
TCGCAAGAGCCCCAACTTGAAGAAAGCAAGAGCCCCAACTTGAAGAAAAGAGGCCCCGTTTCTATCGCCAAATTGGTTTCTATCGCCAAATTGGCCTGGGTCTATCGCCAAATTGGCCTGGGCTTGCCAAATTGGCCTGGGCTTCCGCGCATTGGCCTGGGCTTCCGCGCTCCGGATGGCTGATCAGCAAACCGAACGCTCTGATCAGCAAACCGAACGCTCGTTAAACCGAACGCTCGTTCCGCAAGCATCGTTCCGCAAGCAACACGCGGTGGAAGCAACACGCGGTGGTCGTTGTGCCAACACGCGGTGGTCGTTGTGCGTCCGGTGGTCGTTGTGCGTCGCAAGAG

Full Affymetrix probeset data:

Annotations for 1630252_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720