FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630254_at:

>probe:Drosophila_2:1630254_at:125:519; Interrogation_Position=1298; Antisense; GTGGAGACGGCCAAGCGCACCAATG
>probe:Drosophila_2:1630254_at:3:235; Interrogation_Position=1319; Antisense; AATGCCACCCTGATCATCGTGCTGA
>probe:Drosophila_2:1630254_at:8:37; Interrogation_Position=1397; Antisense; ATCATGGCTATCACGCGCTGCGAAC
>probe:Drosophila_2:1630254_at:665:333; Interrogation_Position=1431; Antisense; GCTGGGTCTATCTGCATCGCGGAGT
>probe:Drosophila_2:1630254_at:426:45; Interrogation_Position=1446; Antisense; ATCGCGGAGTCCTGCCGATACTGTA
>probe:Drosophila_2:1630254_at:193:457; Interrogation_Position=1462; Antisense; GATACTGTACACCTTGGAGCCCAGC
>probe:Drosophila_2:1630254_at:388:719; Interrogation_Position=1523; Antisense; TTCGCCATGACCTCTGCCAAGAAGT
>probe:Drosophila_2:1630254_at:718:409; Interrogation_Position=1559; Antisense; GACGACGGCGATCCCATTGTGATAG
>probe:Drosophila_2:1630254_at:152:69; Interrogation_Position=1599; Antisense; ATGGCGGCGGGTTCACCAACAATGT
>probe:Drosophila_2:1630254_at:433:185; Interrogation_Position=1616; Antisense; AACAATGTCCGTGTGGTCTACGCTT
>probe:Drosophila_2:1630254_at:276:537; Interrogation_Position=1630; Antisense; GGTCTACGCTTTCTTCGAGGCGGAT
>probe:Drosophila_2:1630254_at:284:559; Interrogation_Position=1678; Antisense; GGACAGGCGGCATTCTCGAAAGAAC
>probe:Drosophila_2:1630254_at:72:67; Interrogation_Position=1715; Antisense; ATGGCAAATCGGGAGCCTGCTGATA
>probe:Drosophila_2:1630254_at:34:657; Interrogation_Position=1750; Antisense; TAATGCGTAGCTGAGCCCGGAGAAA

Paste this into a BLAST search page for me
GTGGAGACGGCCAAGCGCACCAATGAATGCCACCCTGATCATCGTGCTGAATCATGGCTATCACGCGCTGCGAACGCTGGGTCTATCTGCATCGCGGAGTATCGCGGAGTCCTGCCGATACTGTAGATACTGTACACCTTGGAGCCCAGCTTCGCCATGACCTCTGCCAAGAAGTGACGACGGCGATCCCATTGTGATAGATGGCGGCGGGTTCACCAACAATGTAACAATGTCCGTGTGGTCTACGCTTGGTCTACGCTTTCTTCGAGGCGGATGGACAGGCGGCATTCTCGAAAGAACATGGCAAATCGGGAGCCTGCTGATATAATGCGTAGCTGAGCCCGGAGAAA

Full Affymetrix probeset data:

Annotations for 1630254_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720