FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630256_at:

>probe:Drosophila_2:1630256_at:465:55; Interrogation_Position=1055; Antisense; ATGAACGATGATCCGTGCCACAGAA
>probe:Drosophila_2:1630256_at:358:179; Interrogation_Position=1122; Antisense; AAACACTGTCTTTGCATATTCGAAA
>probe:Drosophila_2:1630256_at:563:683; Interrogation_Position=725; Antisense; TATACCAAGGTCTTCTGGCCGAAAT
>probe:Drosophila_2:1630256_at:706:237; Interrogation_Position=757; Antisense; AATCGGCTCTAGACTCTTCTACATA
>probe:Drosophila_2:1630256_at:592:235; Interrogation_Position=807; Antisense; AATCCGCTGTAGACTTCTGTCGTGA
>probe:Drosophila_2:1630256_at:688:641; Interrogation_Position=822; Antisense; TCTGTCGTGACATGGGTGGCTATAT
>probe:Drosophila_2:1630256_at:672:19; Interrogation_Position=843; Antisense; ATATAGCCGCCATCAAGGATCAAGA
>probe:Drosophila_2:1630256_at:187:453; Interrogation_Position=860; Antisense; GATCAAGAGGAGCTGGACGCCATTT
>probe:Drosophila_2:1630256_at:220:555; Interrogation_Position=874; Antisense; GGACGCCATTTCAGCGAGACTGGAC
>probe:Drosophila_2:1630256_at:431:407; Interrogation_Position=891; Antisense; GACTGGACGACAAGAGCTACTGGCT
>probe:Drosophila_2:1630256_at:616:669; Interrogation_Position=908; Antisense; TACTGGCTGGGCATAAACGACTTGC
>probe:Drosophila_2:1630256_at:606:89; Interrogation_Position=938; Antisense; AGTAACACCTACGTATCCGTGGCAT
>probe:Drosophila_2:1630256_at:574:629; Interrogation_Position=981; Antisense; TCCTCAATTGGAATGCGGGCGAACC
>probe:Drosophila_2:1630256_at:641:523; Interrogation_Position=997; Antisense; GGGCGAACCCAATCACGGCAATGAA

Paste this into a BLAST search page for me
ATGAACGATGATCCGTGCCACAGAAAAACACTGTCTTTGCATATTCGAAATATACCAAGGTCTTCTGGCCGAAATAATCGGCTCTAGACTCTTCTACATAAATCCGCTGTAGACTTCTGTCGTGATCTGTCGTGACATGGGTGGCTATATATATAGCCGCCATCAAGGATCAAGAGATCAAGAGGAGCTGGACGCCATTTGGACGCCATTTCAGCGAGACTGGACGACTGGACGACAAGAGCTACTGGCTTACTGGCTGGGCATAAACGACTTGCAGTAACACCTACGTATCCGTGGCATTCCTCAATTGGAATGCGGGCGAACCGGGCGAACCCAATCACGGCAATGAA

Full Affymetrix probeset data:

Annotations for 1630256_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720