Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630257_s_at:

>probe:Drosophila_2:1630257_s_at:101:173; Interrogation_Position=115; Antisense; AAAGCGACAAAGGTGGCGCCTCCAA
>probe:Drosophila_2:1630257_s_at:177:583; Interrogation_Position=128; Antisense; TGGCGCCTCCAAATGCTGCAAGAGT
>probe:Drosophila_2:1630257_s_at:488:165; Interrogation_Position=138; Antisense; AAATGCTGCAAGAGTGGGATCACGA
>probe:Drosophila_2:1630257_s_at:255:543; Interrogation_Position=154; Antisense; GGATCACGAACCCTGGAAAGTCTGA
>probe:Drosophila_2:1630257_s_at:620:285; Interrogation_Position=166; Antisense; CTGGAAAGTCTGAAGGGCCTTGGAT
>probe:Drosophila_2:1630257_s_at:40:557; Interrogation_Position=195; Antisense; GGACATTAATACTGTTGCTGTTAAC
>probe:Drosophila_2:1630257_s_at:522:391; Interrogation_Position=21; Antisense; GAAACGAGTTTTGGCTCTGCTCTGC
>probe:Drosophila_2:1630257_s_at:104:659; Interrogation_Position=239; Antisense; TAAGACTTATGACAAACCACCGCCT
>probe:Drosophila_2:1630257_s_at:310:259; Interrogation_Position=256; Antisense; CACCGCCTCAGTTCAGTAACTTATT
>probe:Drosophila_2:1630257_s_at:86:643; Interrogation_Position=36; Antisense; TCTGCTCTGCCTGATTTTGCTGCTG
>probe:Drosophila_2:1630257_s_at:11:621; Interrogation_Position=56; Antisense; TGCTGCCACTTTTCATGGCCGAAAA
>probe:Drosophila_2:1630257_s_at:480:711; Interrogation_Position=67; Antisense; TTCATGGCCGAAAATGCACCTATTA
>probe:Drosophila_2:1630257_s_at:181:231; Interrogation_Position=79; Antisense; AATGCACCTATTAATTTTCCGTCAG
>probe:Drosophila_2:1630257_s_at:252:17; Interrogation_Position=92; Antisense; ATTTTCCGTCAGTTAATCGAGCAAA

Paste this into a BLAST search page for me
AAAGCGACAAAGGTGGCGCCTCCAATGGCGCCTCCAAATGCTGCAAGAGTAAATGCTGCAAGAGTGGGATCACGAGGATCACGAACCCTGGAAAGTCTGACTGGAAAGTCTGAAGGGCCTTGGATGGACATTAATACTGTTGCTGTTAACGAAACGAGTTTTGGCTCTGCTCTGCTAAGACTTATGACAAACCACCGCCTCACCGCCTCAGTTCAGTAACTTATTTCTGCTCTGCCTGATTTTGCTGCTGTGCTGCCACTTTTCATGGCCGAAAATTCATGGCCGAAAATGCACCTATTAAATGCACCTATTAATTTTCCGTCAGATTTTCCGTCAGTTAATCGAGCAAA

Full Affymetrix probeset data:

Annotations for 1630257_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime