FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630258_at:

>probe:Drosophila_2:1630258_at:601:527; Interrogation_Position=117; Antisense; GGGTGAACAATTGAAGCCGGAGTTT
>probe:Drosophila_2:1630258_at:352:77; Interrogation_Position=245; Antisense; AGGATGACTATCTGTTGCCCAACGA
>probe:Drosophila_2:1630258_at:680:137; Interrogation_Position=266; Antisense; ACGATCCCAAGAAGCGTGCCGTGAT
>probe:Drosophila_2:1630258_at:414:401; Interrogation_Position=388; Antisense; GACTTGAAGAGAATCGAAACCGCGT
>probe:Drosophila_2:1630258_at:650:389; Interrogation_Position=403; Antisense; GAAACCGCGTTTGGATTTCTCGACA
>probe:Drosophila_2:1630258_at:602:413; Interrogation_Position=460; Antisense; GACCAGCTCACCGTGGCGGACATTG
>probe:Drosophila_2:1630258_at:453:521; Interrogation_Position=472; Antisense; GTGGCGGACATTGCCATCCTGTCCA
>probe:Drosophila_2:1630258_at:239:257; Interrogation_Position=495; Antisense; CACTGTCTCCACGTTCGAAGTTAGT
>probe:Drosophila_2:1630258_at:682:473; Interrogation_Position=514; Antisense; GTTAGTGAGTTCGACTTCAGCAAGT
>probe:Drosophila_2:1630258_at:522:149; Interrogation_Position=527; Antisense; ACTTCAGCAAGTACTCCAATGTCTC
>probe:Drosophila_2:1630258_at:104:145; Interrogation_Position=539; Antisense; ACTCCAATGTCTCCAGGTGGTACGA
>probe:Drosophila_2:1630258_at:716:305; Interrogation_Position=609; Antisense; CCTCATGGCGATGAAGGCGTTGTTC
>probe:Drosophila_2:1630258_at:230:371; Interrogation_Position=621; Antisense; GAAGGCGTTGTTCGATGCCCGTAAA
>probe:Drosophila_2:1630258_at:404:447; Interrogation_Position=634; Antisense; GATGCCCGTAAATTGGCGGCTAAGT

Paste this into a BLAST search page for me
GGGTGAACAATTGAAGCCGGAGTTTAGGATGACTATCTGTTGCCCAACGAACGATCCCAAGAAGCGTGCCGTGATGACTTGAAGAGAATCGAAACCGCGTGAAACCGCGTTTGGATTTCTCGACAGACCAGCTCACCGTGGCGGACATTGGTGGCGGACATTGCCATCCTGTCCACACTGTCTCCACGTTCGAAGTTAGTGTTAGTGAGTTCGACTTCAGCAAGTACTTCAGCAAGTACTCCAATGTCTCACTCCAATGTCTCCAGGTGGTACGACCTCATGGCGATGAAGGCGTTGTTCGAAGGCGTTGTTCGATGCCCGTAAAGATGCCCGTAAATTGGCGGCTAAGT

Full Affymetrix probeset data:

Annotations for 1630258_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720