FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630260_at:

>probe:Drosophila_2:1630260_at:624:363; Interrogation_Position=107; Antisense; GAATTCACCAGCTAATGTTGCCAGA
>probe:Drosophila_2:1630260_at:430:379; Interrogation_Position=136; Antisense; GAACCTTTTCAAGTGACCCAGTGCA
>probe:Drosophila_2:1630260_at:218:575; Interrogation_Position=265; Antisense; GGCGAATTTTTCATCGGTCTTCAGA
>probe:Drosophila_2:1630260_at:326:537; Interrogation_Position=280; Antisense; GGTCTTCAGAAGCTTTACCTAATGA
>probe:Drosophila_2:1630260_at:234:265; Interrogation_Position=305; Antisense; CTAGAGAACAACCACACGAACTTTT
>probe:Drosophila_2:1630260_at:326:247; Interrogation_Position=335; Antisense; AATTGAAGCATGGTCCTGGCGCTAC
>probe:Drosophila_2:1630260_at:209:583; Interrogation_Position=351; Antisense; TGGCGCTACAGTATACGCTCACTTT
>probe:Drosophila_2:1630260_at:652:15; Interrogation_Position=36; Antisense; ATTTTTATGGACTTTGCTGTTCGAA
>probe:Drosophila_2:1630260_at:332:671; Interrogation_Position=364; Antisense; TACGCTCACTTTGATGACTTTCAAG
>probe:Drosophila_2:1630260_at:190:527; Interrogation_Position=449; Antisense; GGGACTCCCTAAGATACCATATAAA
>probe:Drosophila_2:1630260_at:728:169; Interrogation_Position=476; Antisense; AAAGGTTCTCAACTTTTGATCGTGA
>probe:Drosophila_2:1630260_at:719:531; Interrogation_Position=548; Antisense; GGTGGTTTCACTCATGTTTGTCAAG
>probe:Drosophila_2:1630260_at:250:373; Interrogation_Position=58; Antisense; GAAGTGGGCCAGAGTTCACCACACA
>probe:Drosophila_2:1630260_at:392:157; Interrogation_Position=80; Antisense; ACACGTGTCCTAGTGGCAGTCCAAA

Paste this into a BLAST search page for me
GAATTCACCAGCTAATGTTGCCAGAGAACCTTTTCAAGTGACCCAGTGCAGGCGAATTTTTCATCGGTCTTCAGAGGTCTTCAGAAGCTTTACCTAATGACTAGAGAACAACCACACGAACTTTTAATTGAAGCATGGTCCTGGCGCTACTGGCGCTACAGTATACGCTCACTTTATTTTTATGGACTTTGCTGTTCGAATACGCTCACTTTGATGACTTTCAAGGGGACTCCCTAAGATACCATATAAAAAAGGTTCTCAACTTTTGATCGTGAGGTGGTTTCACTCATGTTTGTCAAGGAAGTGGGCCAGAGTTCACCACACAACACGTGTCCTAGTGGCAGTCCAAA

Full Affymetrix probeset data:

Annotations for 1630260_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720