FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630263_at:

>probe:Drosophila_2:1630263_at:113:449; Interrogation_Position=1000; Antisense; GATCCTCCTGCGTTCTGGAAGGAAA
>probe:Drosophila_2:1630263_at:165:479; Interrogation_Position=1046; Antisense; GTCTTAGCCTTGAAACCGCGACTAA
>probe:Drosophila_2:1630263_at:542:459; Interrogation_Position=577; Antisense; GATATTCCCTATATGAGCTCAGGCA
>probe:Drosophila_2:1630263_at:395:607; Interrogation_Position=590; Antisense; TGAGCTCAGGCATGGGCCCGTTTAA
>probe:Drosophila_2:1630263_at:143:657; Interrogation_Position=612; Antisense; TAAGGATTTTTTGGGCCGCATTCCT
>probe:Drosophila_2:1630263_at:83:579; Interrogation_Position=625; Antisense; GGCCGCATTCCTGAGTTGGACAGAT
>probe:Drosophila_2:1630263_at:70:631; Interrogation_Position=677; Antisense; TCCATTTTATAGACCGACTGCGTGA
>probe:Drosophila_2:1630263_at:388:147; Interrogation_Position=740; Antisense; ACTACGTTCTCTGCCATGGTGACTA
>probe:Drosophila_2:1630263_at:219:533; Interrogation_Position=757; Antisense; GGTGACTACCACACACGTAACATAA
>probe:Drosophila_2:1630263_at:464:305; Interrogation_Position=803; Antisense; CCGGAGGCTTCGAGGATTGCATGCT
>probe:Drosophila_2:1630263_at:350:463; Interrogation_Position=817; Antisense; GATTGCATGCTGCTTGATTACCAAG
>probe:Drosophila_2:1630263_at:214:225; Interrogation_Position=839; Antisense; AAGGATGCTATGTTGCTCCTCTTGC
>probe:Drosophila_2:1630263_at:234:721; Interrogation_Position=860; Antisense; TTGCCTTCGACCTTATGTATTCCAT
>probe:Drosophila_2:1630263_at:102:413; Interrogation_Position=927; Antisense; GACCTTACTGAACTACTACTTCTCA

Paste this into a BLAST search page for me
GATCCTCCTGCGTTCTGGAAGGAAAGTCTTAGCCTTGAAACCGCGACTAAGATATTCCCTATATGAGCTCAGGCATGAGCTCAGGCATGGGCCCGTTTAATAAGGATTTTTTGGGCCGCATTCCTGGCCGCATTCCTGAGTTGGACAGATTCCATTTTATAGACCGACTGCGTGAACTACGTTCTCTGCCATGGTGACTAGGTGACTACCACACACGTAACATAACCGGAGGCTTCGAGGATTGCATGCTGATTGCATGCTGCTTGATTACCAAGAAGGATGCTATGTTGCTCCTCTTGCTTGCCTTCGACCTTATGTATTCCATGACCTTACTGAACTACTACTTCTCA

Full Affymetrix probeset data:

Annotations for 1630263_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720