FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630264_at:

>probe:Drosophila_2:1630264_at:594:29; Interrogation_Position=1090; Antisense; ATACTTCTGTTAAATTTCCCACTTG
>probe:Drosophila_2:1630264_at:76:479; Interrogation_Position=1117; Antisense; GTTTCACTAGTTCTCAATGTGGCTC
>probe:Drosophila_2:1630264_at:617:521; Interrogation_Position=1135; Antisense; GTGGCTCATACAATTTTTGCTCATT
>probe:Drosophila_2:1630264_at:629:225; Interrogation_Position=639; Antisense; AAGGCTTGGCAACGCTTTGTGATCG
>probe:Drosophila_2:1630264_at:40:693; Interrogation_Position=654; Antisense; TTTGTGATCGACTGCGCATGCGTGG
>probe:Drosophila_2:1630264_at:683:347; Interrogation_Position=669; Antisense; GCATGCGTGGCCGAGGATATGATCC
>probe:Drosophila_2:1630264_at:206:79; Interrogation_Position=682; Antisense; AGGATATGATCCTGGACCTCGCCGA
>probe:Drosophila_2:1630264_at:57:225; Interrogation_Position=762; Antisense; AAGGATCAGGTCACTTTCGAGCGCA
>probe:Drosophila_2:1630264_at:618:605; Interrogation_Position=802; Antisense; TGATCATCCACTCCGGTGTGCACTT
>probe:Drosophila_2:1630264_at:719:715; Interrogation_Position=825; Antisense; TTCTCCAAGCGCTACTTCAAGTATC
>probe:Drosophila_2:1630264_at:67:111; Interrogation_Position=868; Antisense; AGAAGGTCAGCCTGCGTGATTGGTT
>probe:Drosophila_2:1630264_at:676:307; Interrogation_Position=919; Antisense; CCTTCGCCATGACCTACTTTAAGAT
>probe:Drosophila_2:1630264_at:279:159; Interrogation_Position=949; Antisense; ACAAGGACTTTGATGACGACGACGA
>probe:Drosophila_2:1630264_at:651:407; Interrogation_Position=975; Antisense; GACGTTGCCGACGACAATGGCGGAA

Paste this into a BLAST search page for me
ATACTTCTGTTAAATTTCCCACTTGGTTTCACTAGTTCTCAATGTGGCTCGTGGCTCATACAATTTTTGCTCATTAAGGCTTGGCAACGCTTTGTGATCGTTTGTGATCGACTGCGCATGCGTGGGCATGCGTGGCCGAGGATATGATCCAGGATATGATCCTGGACCTCGCCGAAAGGATCAGGTCACTTTCGAGCGCATGATCATCCACTCCGGTGTGCACTTTTCTCCAAGCGCTACTTCAAGTATCAGAAGGTCAGCCTGCGTGATTGGTTCCTTCGCCATGACCTACTTTAAGATACAAGGACTTTGATGACGACGACGAGACGTTGCCGACGACAATGGCGGAA

Full Affymetrix probeset data:

Annotations for 1630264_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720