FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630266_at:

>probe:Drosophila_2:1630266_at:578:115; Interrogation_Position=242; Antisense; AGCCGGTCCAGGGACGCCGAAAGAT
>probe:Drosophila_2:1630266_at:65:99; Interrogation_Position=263; Antisense; AGATGTGCGGCGAGGCTCTGATCCA
>probe:Drosophila_2:1630266_at:128:475; Interrogation_Position=307; Antisense; GTTAATGGATTTACACGCCGTGTCA
>probe:Drosophila_2:1630266_at:121:341; Interrogation_Position=355; Antisense; GCTAGAGTGCGAGACCTTATCCGTA
>probe:Drosophila_2:1630266_at:384:705; Interrogation_Position=371; Antisense; TTATCCGTAAGCTACAGCAGCCGGA
>probe:Drosophila_2:1630266_at:281:221; Interrogation_Position=486; Antisense; AAGTGGACGAAAGTTGCGACGCCAT
>probe:Drosophila_2:1630266_at:181:347; Interrogation_Position=518; Antisense; GCATCGCCCACGAGTGTTGCAAGGA
>probe:Drosophila_2:1630266_at:25:225; Interrogation_Position=538; Antisense; AAGGAGGGCTGCACCTACGACGATA
>probe:Drosophila_2:1630266_at:7:409; Interrogation_Position=556; Antisense; GACGATATACTGGACTACTGCGCCT
>probe:Drosophila_2:1630266_at:538:669; Interrogation_Position=571; Antisense; TACTGCGCCTGATGACCAGGATGGC
>probe:Drosophila_2:1630266_at:669:611; Interrogation_Position=648; Antisense; TGAACACGACATGGCTGAGATTTTG
>probe:Drosophila_2:1630266_at:702:135; Interrogation_Position=698; Antisense; ACGACCGGCAGGCTATTTGCAATTC
>probe:Drosophila_2:1630266_at:199:249; Interrogation_Position=717; Antisense; CAATTCATTTTCCTACTACACTTAA
>probe:Drosophila_2:1630266_at:554:663; Interrogation_Position=806; Antisense; TAAAGTTACTCTCCAAGCAGCAGCA

Paste this into a BLAST search page for me
AGCCGGTCCAGGGACGCCGAAAGATAGATGTGCGGCGAGGCTCTGATCCAGTTAATGGATTTACACGCCGTGTCAGCTAGAGTGCGAGACCTTATCCGTATTATCCGTAAGCTACAGCAGCCGGAAAGTGGACGAAAGTTGCGACGCCATGCATCGCCCACGAGTGTTGCAAGGAAAGGAGGGCTGCACCTACGACGATAGACGATATACTGGACTACTGCGCCTTACTGCGCCTGATGACCAGGATGGCTGAACACGACATGGCTGAGATTTTGACGACCGGCAGGCTATTTGCAATTCCAATTCATTTTCCTACTACACTTAATAAAGTTACTCTCCAAGCAGCAGCA

Full Affymetrix probeset data:

Annotations for 1630266_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720