Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630267_at:

>probe:Drosophila_2:1630267_at:511:597; Interrogation_Position=1009; Antisense; TGTGCCGTATCCATTCGAGTTTAGA
>probe:Drosophila_2:1630267_at:605:139; Interrogation_Position=1143; Antisense; ACGTGTCCAGGTTTTCAATAGCGAT
>probe:Drosophila_2:1630267_at:199:675; Interrogation_Position=1161; Antisense; TAGCGATTTCCTCTGTGATTTTTTC
>probe:Drosophila_2:1630267_at:612:601; Interrogation_Position=1176; Antisense; TGATTTTTTCGCTTTTGTTCGCCAT
>probe:Drosophila_2:1630267_at:524:469; Interrogation_Position=1192; Antisense; GTTCGCCATTGTTCGCGGATATTTT
>probe:Drosophila_2:1630267_at:581:289; Interrogation_Position=1207; Antisense; CGGATATTTTCCTGCAACCAAGTCG
>probe:Drosophila_2:1630267_at:62:185; Interrogation_Position=1261; Antisense; AAAAGTCTTTTCCTTGTTGCGCATT
>probe:Drosophila_2:1630267_at:6:99; Interrogation_Position=1288; Antisense; AGATGAAGTCGGATTTTCCCCTCTG
>probe:Drosophila_2:1630267_at:54:519; Interrogation_Position=1325; Antisense; GTGGTCCTGGCCTTGATTAGCTTTC
>probe:Drosophila_2:1630267_at:260:163; Interrogation_Position=1384; Antisense; AAATCACTTTGGCACTGGTTTATAT
>probe:Drosophila_2:1630267_at:596:475; Interrogation_Position=1420; Antisense; GTTTAACCTTGTGGGCACGGGCGCA
>probe:Drosophila_2:1630267_at:56:277; Interrogation_Position=1455; Antisense; CTTTTCGGCGTGTCACTATTGTGGA
>probe:Drosophila_2:1630267_at:4:543; Interrogation_Position=1477; Antisense; GGATTGTGGGTTTGTGCCCCTCATA
>probe:Drosophila_2:1630267_at:141:175; Interrogation_Position=983; Antisense; AAAGCCACGCTAATTAATTGCCAGT

Paste this into a BLAST search page for me
TGTGCCGTATCCATTCGAGTTTAGAACGTGTCCAGGTTTTCAATAGCGATTAGCGATTTCCTCTGTGATTTTTTCTGATTTTTTCGCTTTTGTTCGCCATGTTCGCCATTGTTCGCGGATATTTTCGGATATTTTCCTGCAACCAAGTCGAAAAGTCTTTTCCTTGTTGCGCATTAGATGAAGTCGGATTTTCCCCTCTGGTGGTCCTGGCCTTGATTAGCTTTCAAATCACTTTGGCACTGGTTTATATGTTTAACCTTGTGGGCACGGGCGCACTTTTCGGCGTGTCACTATTGTGGAGGATTGTGGGTTTGTGCCCCTCATAAAAGCCACGCTAATTAATTGCCAGT

Full Affymetrix probeset data:

Annotations for 1630267_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime