FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630271_at:

>probe:Drosophila_2:1630271_at:700:441; Interrogation_Position=3199; Antisense; GATGGTCTTTGTGGCAGTGTCTATA
>probe:Drosophila_2:1630271_at:251:515; Interrogation_Position=3215; Antisense; GTGTCTATACCAAAACTGGCCCGTA
>probe:Drosophila_2:1630271_at:137:387; Interrogation_Position=3242; Antisense; GAAAATTCCTTCTACAGAGCCACAA
>probe:Drosophila_2:1630271_at:575:69; Interrogation_Position=3270; Antisense; ATGGCCACTCAAATAACACGCACTG
>probe:Drosophila_2:1630271_at:63:583; Interrogation_Position=3297; Antisense; TGGCGGCGGCCATTAATAACATCTT
>probe:Drosophila_2:1630271_at:437:31; Interrogation_Position=3312; Antisense; ATAACATCTTCGGAGCCCTGTTTAC
>probe:Drosophila_2:1630271_at:413:393; Interrogation_Position=3370; Antisense; GAAAGAGTTCCTTGCTCTGGCCAGT
>probe:Drosophila_2:1630271_at:684:201; Interrogation_Position=3443; Antisense; AACCGAGAGTCCATCTATTTGCTGC
>probe:Drosophila_2:1630271_at:399:251; Interrogation_Position=3501; Antisense; CAATGGATCTGCTTGAGTCCTGCTT
>probe:Drosophila_2:1630271_at:34:697; Interrogation_Position=3524; Antisense; TTTCCCTACGTGCTTATACGCAACG
>probe:Drosophila_2:1630271_at:150:387; Interrogation_Position=3572; Antisense; GAACAGATCTTAGGGCTGGCACTCT
>probe:Drosophila_2:1630271_at:55:555; Interrogation_Position=3601; Antisense; GGAGCCGATCTGTGTATTCCACATA
>probe:Drosophila_2:1630271_at:215:617; Interrogation_Position=3627; Antisense; TGCTTATGTAGTTTATCCGCCGATC
>probe:Drosophila_2:1630271_at:384:405; Interrogation_Position=3717; Antisense; GACTCTGCATTTTTATACTCGTACG

Paste this into a BLAST search page for me
GATGGTCTTTGTGGCAGTGTCTATAGTGTCTATACCAAAACTGGCCCGTAGAAAATTCCTTCTACAGAGCCACAAATGGCCACTCAAATAACACGCACTGTGGCGGCGGCCATTAATAACATCTTATAACATCTTCGGAGCCCTGTTTACGAAAGAGTTCCTTGCTCTGGCCAGTAACCGAGAGTCCATCTATTTGCTGCCAATGGATCTGCTTGAGTCCTGCTTTTTCCCTACGTGCTTATACGCAACGGAACAGATCTTAGGGCTGGCACTCTGGAGCCGATCTGTGTATTCCACATATGCTTATGTAGTTTATCCGCCGATCGACTCTGCATTTTTATACTCGTACG

Full Affymetrix probeset data:

Annotations for 1630271_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720