Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630272_at:

>probe:Drosophila_2:1630272_at:89:321; Interrogation_Position=3740; Antisense; GCCCCTTCCTGCAACGAATAGAGTT
>probe:Drosophila_2:1630272_at:299:181; Interrogation_Position=3768; Antisense; AAAACCGAACGCTGTGGCTGGCATA
>probe:Drosophila_2:1630272_at:720:569; Interrogation_Position=3787; Antisense; GGCATAGCCGTGTTGCTTTACGAAA
>probe:Drosophila_2:1630272_at:261:161; Interrogation_Position=3827; Antisense; ACAAGCATCATGGTCCGAAGCCTCT
>probe:Drosophila_2:1630272_at:378:379; Interrogation_Position=3843; Antisense; GAAGCCTCTGCAGTACATGGACCAG
>probe:Drosophila_2:1630272_at:332:641; Interrogation_Position=3869; Antisense; TCTGCGATTTCCTCTATCACATTAA
>probe:Drosophila_2:1630272_at:600:379; Interrogation_Position=3921; Antisense; GAACGAATCGGAAGCCATCATTAAG
>probe:Drosophila_2:1630272_at:245:167; Interrogation_Position=3965; Antisense; AAATGCGCCTGAGGTTCATAACCCA
>probe:Drosophila_2:1630272_at:665:469; Interrogation_Position=3978; Antisense; GTTCATAACCCACCTTAACTTGGAG
>probe:Drosophila_2:1630272_at:149:659; Interrogation_Position=3993; Antisense; TAACTTGGAGGATATTCACACTGAA
>probe:Drosophila_2:1630272_at:364:127; Interrogation_Position=4054; Antisense; AGCCAAACGCAGTCTCCAATGCAAA
>probe:Drosophila_2:1630272_at:654:111; Interrogation_Position=4181; Antisense; AGCAGCAACAAATCAACGCAGTACA
>probe:Drosophila_2:1630272_at:84:89; Interrogation_Position=4200; Antisense; AGTACAAACAACCAGCGTTCCCTTG
>probe:Drosophila_2:1630272_at:383:357; Interrogation_Position=4305; Antisense; GCACATGCAAAACATGCGCCACAAT

Paste this into a BLAST search page for me
GCCCCTTCCTGCAACGAATAGAGTTAAAACCGAACGCTGTGGCTGGCATAGGCATAGCCGTGTTGCTTTACGAAAACAAGCATCATGGTCCGAAGCCTCTGAAGCCTCTGCAGTACATGGACCAGTCTGCGATTTCCTCTATCACATTAAGAACGAATCGGAAGCCATCATTAAGAAATGCGCCTGAGGTTCATAACCCAGTTCATAACCCACCTTAACTTGGAGTAACTTGGAGGATATTCACACTGAAAGCCAAACGCAGTCTCCAATGCAAAAGCAGCAACAAATCAACGCAGTACAAGTACAAACAACCAGCGTTCCCTTGGCACATGCAAAACATGCGCCACAAT

Full Affymetrix probeset data:

Annotations for 1630272_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime