FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630273_at:

>probe:Drosophila_2:1630273_at:569:109; Interrogation_Position=1354; Antisense; AGCACACTGACTAGCGATCTTATCG
>probe:Drosophila_2:1630273_at:193:641; Interrogation_Position=1398; Antisense; TCTGTATTTGTTCTCATCGGATAGT
>probe:Drosophila_2:1630273_at:676:573; Interrogation_Position=1447; Antisense; GGCTGGTACGAAGCTCATGCCATAA
>probe:Drosophila_2:1630273_at:347:11; Interrogation_Position=1483; Antisense; ATTCGACAATCGGTGCCTGGCAGAC
>probe:Drosophila_2:1630273_at:417:387; Interrogation_Position=1540; Antisense; GAAAACTATATTGATCTGCTGGACA
>probe:Drosophila_2:1630273_at:19:519; Interrogation_Position=1621; Antisense; GTGGTGCATCGAGCATATTCGCATG
>probe:Drosophila_2:1630273_at:577:9; Interrogation_Position=1637; Antisense; ATTCGCATGAAAACCTTACCAGCAG
>probe:Drosophila_2:1630273_at:494:673; Interrogation_Position=1653; Antisense; TACCAGCAGCGCCAATTTTCGATTG
>probe:Drosophila_2:1630273_at:486:531; Interrogation_Position=1684; Antisense; GGTGTTTGGCAACAACTACCACAAA
>probe:Drosophila_2:1630273_at:53:459; Interrogation_Position=1717; Antisense; GATTTCAGTTACGATCCCAGTACGA
>probe:Drosophila_2:1630273_at:509:353; Interrogation_Position=1790; Antisense; GCACAGTTAAGGGTTTCTTCTCAGA
>probe:Drosophila_2:1630273_at:635:385; Interrogation_Position=1865; Antisense; GAACAGATTCCGACGCCGAAGACGA
>probe:Drosophila_2:1630273_at:114:375; Interrogation_Position=1882; Antisense; GAAGACGATCCTTGGCCATGGTTAC
>probe:Drosophila_2:1630273_at:529:491; Interrogation_Position=1913; Antisense; GTAAGAGTCAAAGTTCATCCCAGGA

Paste this into a BLAST search page for me
AGCACACTGACTAGCGATCTTATCGTCTGTATTTGTTCTCATCGGATAGTGGCTGGTACGAAGCTCATGCCATAAATTCGACAATCGGTGCCTGGCAGACGAAAACTATATTGATCTGCTGGACAGTGGTGCATCGAGCATATTCGCATGATTCGCATGAAAACCTTACCAGCAGTACCAGCAGCGCCAATTTTCGATTGGGTGTTTGGCAACAACTACCACAAAGATTTCAGTTACGATCCCAGTACGAGCACAGTTAAGGGTTTCTTCTCAGAGAACAGATTCCGACGCCGAAGACGAGAAGACGATCCTTGGCCATGGTTACGTAAGAGTCAAAGTTCATCCCAGGA

Full Affymetrix probeset data:

Annotations for 1630273_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720