FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630276_at:

>probe:Drosophila_2:1630276_at:32:593; Interrogation_Position=1346; Antisense; TGGGCCGTAGGAGACTTACCAGTTA
>probe:Drosophila_2:1630276_at:119:167; Interrogation_Position=1386; Antisense; AAGGCGACGGTCACAAACGTTCTGT
>probe:Drosophila_2:1630276_at:628:197; Interrogation_Position=1401; Antisense; AACGTTCTGTGCTGGATGGCAATTT
>probe:Drosophila_2:1630276_at:96:361; Interrogation_Position=1419; Antisense; GCAATTTGGAAGATCGGGCCATGTT
>probe:Drosophila_2:1630276_at:222:167; Interrogation_Position=1461; Antisense; AAATGCACTCGGATGGATTGCGTGA
>probe:Drosophila_2:1630276_at:51:589; Interrogation_Position=1474; Antisense; TGGATTGCGTGAGCCCAACATGGAT
>probe:Drosophila_2:1630276_at:655:363; Interrogation_Position=1550; Antisense; GAATTTGTGAGACCATGCCCGATAT
>probe:Drosophila_2:1630276_at:302:319; Interrogation_Position=1566; Antisense; GCCCGATATGGGTGTGCAGTTAATG
>probe:Drosophila_2:1630276_at:498:461; Interrogation_Position=1590; Antisense; GATTCAATTCAGTTTCCTTAGCTTT
>probe:Drosophila_2:1630276_at:16:277; Interrogation_Position=1606; Antisense; CTTAGCTTTTTTGCAATCCCTATCG
>probe:Drosophila_2:1630276_at:196:725; Interrogation_Position=1616; Antisense; TTGCAATCCCTATCGAACACACAAA
>probe:Drosophila_2:1630276_at:99:431; Interrogation_Position=1660; Antisense; GAGTATTTGTTCAATCCATTCCTAT
>probe:Drosophila_2:1630276_at:564:429; Interrogation_Position=1754; Antisense; GAGTATTGTTGTTGCGTTTTAGATC
>probe:Drosophila_2:1630276_at:447:715; Interrogation_Position=1857; Antisense; TTCCCATTTTTATCCTACGTCAATA

Paste this into a BLAST search page for me
TGGGCCGTAGGAGACTTACCAGTTAAAGGCGACGGTCACAAACGTTCTGTAACGTTCTGTGCTGGATGGCAATTTGCAATTTGGAAGATCGGGCCATGTTAAATGCACTCGGATGGATTGCGTGATGGATTGCGTGAGCCCAACATGGATGAATTTGTGAGACCATGCCCGATATGCCCGATATGGGTGTGCAGTTAATGGATTCAATTCAGTTTCCTTAGCTTTCTTAGCTTTTTTGCAATCCCTATCGTTGCAATCCCTATCGAACACACAAAGAGTATTTGTTCAATCCATTCCTATGAGTATTGTTGTTGCGTTTTAGATCTTCCCATTTTTATCCTACGTCAATA

Full Affymetrix probeset data:

Annotations for 1630276_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720