Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630277_at:

>probe:Drosophila_2:1630277_at:379:487; Interrogation_Position=2533; Antisense; GTACGAACTCGAGATATCCGCATCC
>probe:Drosophila_2:1630277_at:340:683; Interrogation_Position=2547; Antisense; TATCCGCATCCCAACCAAGGTTATG
>probe:Drosophila_2:1630277_at:478:677; Interrogation_Position=2568; Antisense; TATGGTTTACCACAACAACGCCGGG
>probe:Drosophila_2:1630277_at:166:519; Interrogation_Position=2590; Antisense; GGGCGATTTCCGATGTGGTTCCTCC
>probe:Drosophila_2:1630277_at:550:635; Interrogation_Position=2621; Antisense; TCGAGGTGACCGACATTCAGACTGG
>probe:Drosophila_2:1630277_at:91:421; Interrogation_Position=2647; Antisense; GAGACGCAGGTGTTTTTAGCCCGGA
>probe:Drosophila_2:1630277_at:187:223; Interrogation_Position=2683; Antisense; AAGGGTACACTGTTGATGTCTTCAA
>probe:Drosophila_2:1630277_at:220:641; Interrogation_Position=2783; Antisense; TCTGGATTAATTGGTCGCTGTGGCA
>probe:Drosophila_2:1630277_at:48:325; Interrogation_Position=2799; Antisense; GCTGTGGCAACCAGTGACCGGCAGT
>probe:Drosophila_2:1630277_at:541:93; Interrogation_Position=2821; Antisense; AGTTGGAGGGAGTCCGCCCATTATC
>probe:Drosophila_2:1630277_at:251:15; Interrogation_Position=2840; Antisense; ATTATCCACGAATGTCCCGAGCCAA
>probe:Drosophila_2:1630277_at:318:429; Interrogation_Position=2875; Antisense; GAGTTCATCTGCAAACTGTTGGTCA
>probe:Drosophila_2:1630277_at:118:683; Interrogation_Position=2909; Antisense; TATGCGCTTCATTCTTTGGCGTTAC
>probe:Drosophila_2:1630277_at:140:509; Interrogation_Position=2992; Antisense; GTGCTAACCATGATATGCTCTTTTG

Paste this into a BLAST search page for me
GTACGAACTCGAGATATCCGCATCCTATCCGCATCCCAACCAAGGTTATGTATGGTTTACCACAACAACGCCGGGGGGCGATTTCCGATGTGGTTCCTCCTCGAGGTGACCGACATTCAGACTGGGAGACGCAGGTGTTTTTAGCCCGGAAAGGGTACACTGTTGATGTCTTCAATCTGGATTAATTGGTCGCTGTGGCAGCTGTGGCAACCAGTGACCGGCAGTAGTTGGAGGGAGTCCGCCCATTATCATTATCCACGAATGTCCCGAGCCAAGAGTTCATCTGCAAACTGTTGGTCATATGCGCTTCATTCTTTGGCGTTACGTGCTAACCATGATATGCTCTTTTG

Full Affymetrix probeset data:

Annotations for 1630277_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime