FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630281_at:

>probe:Drosophila_2:1630281_at:576:345; Interrogation_Position=105; Antisense; GCATCATTTATCAGCGACGCATCGC
>probe:Drosophila_2:1630281_at:125:45; Interrogation_Position=130; Antisense; ATCCCATCGCATCAACTAGCAGCAG
>probe:Drosophila_2:1630281_at:435:111; Interrogation_Position=165; Antisense; AGCAACCCGGCGAGGCATATGTGCA
>probe:Drosophila_2:1630281_at:674:679; Interrogation_Position=182; Antisense; TATGTGCACCGGAGATGCCGGCATT
>probe:Drosophila_2:1630281_at:487:273; Interrogation_Position=203; Antisense; CATTGTGTGGTTGCCGTAGCTGAAA
>probe:Drosophila_2:1630281_at:279:79; Interrogation_Position=227; Antisense; AGGATTCAGCGCGTTCATTCAAAAA
>probe:Drosophila_2:1630281_at:569:349; Interrogation_Position=282; Antisense; GCAGTCAGACAATACGATCCGCCCG
>probe:Drosophila_2:1630281_at:258:187; Interrogation_Position=366; Antisense; AACAGAGAAATCACGGGCCTGGCGA
>probe:Drosophila_2:1630281_at:218:225; Interrogation_Position=401; Antisense; AAGGATGCCAATGGTGCCGCCACGG
>probe:Drosophila_2:1630281_at:117:617; Interrogation_Position=451; Antisense; TGCACCTGATGGAACTGCGCATCCT
>probe:Drosophila_2:1630281_at:574:329; Interrogation_Position=571; Antisense; GCGGCGGTATAAATGGCGACTCAAA
>probe:Drosophila_2:1630281_at:296:637; Interrogation_Position=610; Antisense; TCGACTCGAGCGACAGTCCAATGTT
>probe:Drosophila_2:1630281_at:352:489; Interrogation_Position=648; Antisense; GTAACACGGCGGGTACGAGTCCGAT
>probe:Drosophila_2:1630281_at:112:443; Interrogation_Position=670; Antisense; GATGTGATCTGGACTCCATTGCCGG

Paste this into a BLAST search page for me
GCATCATTTATCAGCGACGCATCGCATCCCATCGCATCAACTAGCAGCAGAGCAACCCGGCGAGGCATATGTGCATATGTGCACCGGAGATGCCGGCATTCATTGTGTGGTTGCCGTAGCTGAAAAGGATTCAGCGCGTTCATTCAAAAAGCAGTCAGACAATACGATCCGCCCGAACAGAGAAATCACGGGCCTGGCGAAAGGATGCCAATGGTGCCGCCACGGTGCACCTGATGGAACTGCGCATCCTGCGGCGGTATAAATGGCGACTCAAATCGACTCGAGCGACAGTCCAATGTTGTAACACGGCGGGTACGAGTCCGATGATGTGATCTGGACTCCATTGCCGG

Full Affymetrix probeset data:

Annotations for 1630281_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720