FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630282_at:

>probe:Drosophila_2:1630282_at:460:605; Interrogation_Position=14; Antisense; TGAGGACGACCACTCTACTTTTGAG
>probe:Drosophila_2:1630282_at:481:143; Interrogation_Position=283; Antisense; ACTGATGGAAGCACCTCCCCATCGA
>probe:Drosophila_2:1630282_at:428:667; Interrogation_Position=29; Antisense; TACTTTTGAGCCTTGGCCTTCTGGT
>probe:Drosophila_2:1630282_at:278:413; Interrogation_Position=306; Antisense; GACCTCTCCTTCAACAGGCGATAAC
>probe:Drosophila_2:1630282_at:250:573; Interrogation_Position=322; Antisense; GGCGATAACACTAGTCCTTCAACAG
>probe:Drosophila_2:1630282_at:309:677; Interrogation_Position=333; Antisense; TAGTCCTTCAACAGGATCGCCAGAT
>probe:Drosophila_2:1630282_at:384:159; Interrogation_Position=404; Antisense; ACAAGCGGAACAACCGTCGGAGGCG
>probe:Drosophila_2:1630282_at:439:715; Interrogation_Position=47; Antisense; TTCTGGTCCTGTGCTTTTCCAGCTA
>probe:Drosophila_2:1630282_at:401:641; Interrogation_Position=474; Antisense; TCGGCGCAGGAGGAACCGTCGCAAT
>probe:Drosophila_2:1630282_at:466:561; Interrogation_Position=485; Antisense; GGAACCGTCGCAATAACAGGAATAA
>probe:Drosophila_2:1630282_at:583:273; Interrogation_Position=60; Antisense; CTTTTCCAGCTACAGTTTTGCCGAA
>probe:Drosophila_2:1630282_at:457:153; Interrogation_Position=71; Antisense; ACAGTTTTGCCGAAGACGATCCCAC
>probe:Drosophila_2:1630282_at:708:375; Interrogation_Position=82; Antisense; GAAGACGATCCCACCGATGGAAGCA
>probe:Drosophila_2:1630282_at:543:293; Interrogation_Position=96; Antisense; CGATGGAAGCACAACGCCTACTGAT

Paste this into a BLAST search page for me
TGAGGACGACCACTCTACTTTTGAGACTGATGGAAGCACCTCCCCATCGATACTTTTGAGCCTTGGCCTTCTGGTGACCTCTCCTTCAACAGGCGATAACGGCGATAACACTAGTCCTTCAACAGTAGTCCTTCAACAGGATCGCCAGATACAAGCGGAACAACCGTCGGAGGCGTTCTGGTCCTGTGCTTTTCCAGCTATCGGCGCAGGAGGAACCGTCGCAATGGAACCGTCGCAATAACAGGAATAACTTTTCCAGCTACAGTTTTGCCGAAACAGTTTTGCCGAAGACGATCCCACGAAGACGATCCCACCGATGGAAGCACGATGGAAGCACAACGCCTACTGAT

Full Affymetrix probeset data:

Annotations for 1630282_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720