FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630283_at:

>probe:Drosophila_2:1630283_at:218:409; Interrogation_Position=1056; Antisense; GACGTATCCAGAAGCGTGCGCAGGA
>probe:Drosophila_2:1630283_at:426:587; Interrogation_Position=1149; Antisense; TGGACCCAGCCGATGTCTTTGAATC
>probe:Drosophila_2:1630283_at:75:665; Interrogation_Position=1188; Antisense; TAAAGGCCTGTTTCGAGTCCCGCGA
>probe:Drosophila_2:1630283_at:701:87; Interrogation_Position=1203; Antisense; AGTCCCGCGACGTAGAGCTGCTGCA
>probe:Drosophila_2:1630283_at:589:621; Interrogation_Position=1221; Antisense; TGCTGCAGAAGACCATTGCGGCCAT
>probe:Drosophila_2:1630283_at:177:557; Interrogation_Position=1252; Antisense; GGACGTCGCCAAGCTGCACATGAAG
>probe:Drosophila_2:1630283_at:286:379; Interrogation_Position=1273; Antisense; GAAGCGTTGTGTGGACTCTGGTCTC
>probe:Drosophila_2:1630283_at:651:233; Interrogation_Position=1307; Antisense; AATGCCGCTGACTTGGAGGGTGACA
>probe:Drosophila_2:1630283_at:41:99; Interrogation_Position=1342; Antisense; AGATGACTCGGATGACGTCGCCGGT
>probe:Drosophila_2:1630283_at:572:437; Interrogation_Position=1412; Antisense; GAGGAGCCCATCTACACTGGCGTCA
>probe:Drosophila_2:1630283_at:540:437; Interrogation_Position=1442; Antisense; GAGGACGTTGACTGATCGCCGCCAC
>probe:Drosophila_2:1630283_at:398:695; Interrogation_Position=1468; Antisense; TTTCCATCTACACCATAGCTCTAAT
>probe:Drosophila_2:1630283_at:148:689; Interrogation_Position=1516; Antisense; TATTTCATCCATAGCCAGATCCTGC
>probe:Drosophila_2:1630283_at:81:173; Interrogation_Position=991; Antisense; AAAGATCCAGCACTGTCATCCCGAG

Paste this into a BLAST search page for me
GACGTATCCAGAAGCGTGCGCAGGATGGACCCAGCCGATGTCTTTGAATCTAAAGGCCTGTTTCGAGTCCCGCGAAGTCCCGCGACGTAGAGCTGCTGCATGCTGCAGAAGACCATTGCGGCCATGGACGTCGCCAAGCTGCACATGAAGGAAGCGTTGTGTGGACTCTGGTCTCAATGCCGCTGACTTGGAGGGTGACAAGATGACTCGGATGACGTCGCCGGTGAGGAGCCCATCTACACTGGCGTCAGAGGACGTTGACTGATCGCCGCCACTTTCCATCTACACCATAGCTCTAATTATTTCATCCATAGCCAGATCCTGCAAAGATCCAGCACTGTCATCCCGAG

Full Affymetrix probeset data:

Annotations for 1630283_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720