FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630284_at:

>probe:Drosophila_2:1630284_at:575:125; Interrogation_Position=1058; Antisense; AGCCGCAATCCGATCGGGAACGGGA
>probe:Drosophila_2:1630284_at:549:603; Interrogation_Position=1136; Antisense; TGTTCGATGCCCTGGACCTGGAGTA
>probe:Drosophila_2:1630284_at:61:91; Interrogation_Position=1157; Antisense; AGTACGTGCTCTTGAGGGCCGCTGC
>probe:Drosophila_2:1630284_at:83:519; Interrogation_Position=1192; Antisense; GTGGGTCCCTACAGCCTCAGTGAGT
>probe:Drosophila_2:1630284_at:409:125; Interrogation_Position=1204; Antisense; AGCCTCAGTGAGTCCATGCACAAGC
>probe:Drosophila_2:1630284_at:601:53; Interrogation_Position=1219; Antisense; ATGCACAAGCTCACCTTCACGCAAT
>probe:Drosophila_2:1630284_at:509:711; Interrogation_Position=1234; Antisense; TTCACGCAATCTTTGGCATTCCCGG
>probe:Drosophila_2:1630284_at:729:243; Interrogation_Position=1278; Antisense; CACCAAAAGGCGGAGGTCGGCCACG
>probe:Drosophila_2:1630284_at:74:615; Interrogation_Position=1322; Antisense; TGAATCCCCATGAGTCCGGTCTGAA
>probe:Drosophila_2:1630284_at:224:55; Interrogation_Position=1331; Antisense; ATGAGTCCGGTCTGAATACCTGCGC
>probe:Drosophila_2:1630284_at:278:65; Interrogation_Position=1396; Antisense; ATGGTGTTCCTCATCGTCTACAAGT
>probe:Drosophila_2:1630284_at:570:427; Interrogation_Position=859; Antisense; GAGTTCCACGACAATGGACTGGCCA
>probe:Drosophila_2:1630284_at:589:135; Interrogation_Position=916; Antisense; ACGACGTCGTCGCTGACATCCGTGG
>probe:Drosophila_2:1630284_at:581:621; Interrogation_Position=969; Antisense; TGCGGGTGGTGCGAACACTACCTCC

Paste this into a BLAST search page for me
AGCCGCAATCCGATCGGGAACGGGATGTTCGATGCCCTGGACCTGGAGTAAGTACGTGCTCTTGAGGGCCGCTGCGTGGGTCCCTACAGCCTCAGTGAGTAGCCTCAGTGAGTCCATGCACAAGCATGCACAAGCTCACCTTCACGCAATTTCACGCAATCTTTGGCATTCCCGGCACCAAAAGGCGGAGGTCGGCCACGTGAATCCCCATGAGTCCGGTCTGAAATGAGTCCGGTCTGAATACCTGCGCATGGTGTTCCTCATCGTCTACAAGTGAGTTCCACGACAATGGACTGGCCAACGACGTCGTCGCTGACATCCGTGGTGCGGGTGGTGCGAACACTACCTCC

Full Affymetrix probeset data:

Annotations for 1630284_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720