FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630285_at:

>probe:Drosophila_2:1630285_at:613:235; Interrogation_Position=8606; Antisense; AATCGGACACATAGGCAAAGTTGGC
>probe:Drosophila_2:1630285_at:232:547; Interrogation_Position=8632; Antisense; GGATGCAGATTCAGATTGTGTTCAA
>probe:Drosophila_2:1630285_at:297:591; Interrogation_Position=8648; Antisense; TGTGTTCAAAACCTAATCTCCAAGT
>probe:Drosophila_2:1630285_at:625:491; Interrogation_Position=8671; Antisense; GTAAAATCGATCGATTCCTCGCAGG
>probe:Drosophila_2:1630285_at:165:9; Interrogation_Position=8684; Antisense; ATTCCTCGCAGGTACTTTCGGATAG
>probe:Drosophila_2:1630285_at:314:427; Interrogation_Position=8710; Antisense; GAGATCGGAATCTGTTGTACCACGA
>probe:Drosophila_2:1630285_at:106:487; Interrogation_Position=8726; Antisense; GTACCACGATTTGGCTAGTTTCGAT
>probe:Drosophila_2:1630285_at:65:345; Interrogation_Position=8780; Antisense; GCATTAAATGCCTATACTTTCGTTT
>probe:Drosophila_2:1630285_at:684:259; Interrogation_Position=8831; Antisense; CACCCGCACCTTTGTATACTTTATT
>probe:Drosophila_2:1630285_at:156:695; Interrogation_Position=8855; Antisense; TTTTGCCCACCTTAATAACATTTTG
>probe:Drosophila_2:1630285_at:136:655; Interrogation_Position=8867; Antisense; TAATAACATTTTGACGCTTTACGGG
>probe:Drosophila_2:1630285_at:565:723; Interrogation_Position=8897; Antisense; TTGTCATGGTTTTTCGAGCGGTTTG
>probe:Drosophila_2:1630285_at:719:387; Interrogation_Position=8939; Antisense; GAAAAGATTTCTTCTGTCGAACTTA
>probe:Drosophila_2:1630285_at:21:589; Interrogation_Position=8973; Antisense; TGGAGACCAAATGCTCAGGGCTTTA

Paste this into a BLAST search page for me
AATCGGACACATAGGCAAAGTTGGCGGATGCAGATTCAGATTGTGTTCAATGTGTTCAAAACCTAATCTCCAAGTGTAAAATCGATCGATTCCTCGCAGGATTCCTCGCAGGTACTTTCGGATAGGAGATCGGAATCTGTTGTACCACGAGTACCACGATTTGGCTAGTTTCGATGCATTAAATGCCTATACTTTCGTTTCACCCGCACCTTTGTATACTTTATTTTTTGCCCACCTTAATAACATTTTGTAATAACATTTTGACGCTTTACGGGTTGTCATGGTTTTTCGAGCGGTTTGGAAAAGATTTCTTCTGTCGAACTTATGGAGACCAAATGCTCAGGGCTTTA

Full Affymetrix probeset data:

Annotations for 1630285_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720