FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630286_at:

>probe:Drosophila_2:1630286_at:294:589; Interrogation_Position=1006; Antisense; TGGATCAAGGACGACCTCTCCGGAG
>probe:Drosophila_2:1630286_at:208:75; Interrogation_Position=1013; Antisense; AGGACGACCTCTCCGGAGACTACAG
>probe:Drosophila_2:1630286_at:577:551; Interrogation_Position=1027; Antisense; GGAGACTACAGCTACGTCTTGCAGT
>probe:Drosophila_2:1630286_at:426:117; Interrogation_Position=1036; Antisense; AGCTACGTCTTGCAGTGCCTGGCCT
>probe:Drosophila_2:1630286_at:25:581; Interrogation_Position=1055; Antisense; TGGCCTCCTACTAAGGATTTCCTCG
>probe:Drosophila_2:1630286_at:612:77; Interrogation_Position=1068; Antisense; AGGATTTCCTCGTTGGATCGATTGT
>probe:Drosophila_2:1630286_at:187:545; Interrogation_Position=1082; Antisense; GGATCGATTGTTAACCATTCTATTT
>probe:Drosophila_2:1630286_at:682:127; Interrogation_Position=1095; Antisense; ACCATTCTATTTGTTGTAACTCTTA
>probe:Drosophila_2:1630286_at:146:493; Interrogation_Position=1110; Antisense; GTAACTCTTACTTTAAGGCAAGCAT
>probe:Drosophila_2:1630286_at:112:73; Interrogation_Position=1125; Antisense; AGGCAAGCATCGTTTGCCAACTGTT
>probe:Drosophila_2:1630286_at:310:43; Interrogation_Position=1133; Antisense; ATCGTTTGCCAACTGTTTTGCGGAA
>probe:Drosophila_2:1630286_at:281:475; Interrogation_Position=1147; Antisense; GTTTTGCGGAAGATTCATAGCCTAT
>probe:Drosophila_2:1630286_at:516:11; Interrogation_Position=1159; Antisense; ATTCATAGCCTATGTTCAATTCATA
>probe:Drosophila_2:1630286_at:555:165; Interrogation_Position=1183; Antisense; AAATGCACTGTAAAATCGCGGTAAA

Paste this into a BLAST search page for me
TGGATCAAGGACGACCTCTCCGGAGAGGACGACCTCTCCGGAGACTACAGGGAGACTACAGCTACGTCTTGCAGTAGCTACGTCTTGCAGTGCCTGGCCTTGGCCTCCTACTAAGGATTTCCTCGAGGATTTCCTCGTTGGATCGATTGTGGATCGATTGTTAACCATTCTATTTACCATTCTATTTGTTGTAACTCTTAGTAACTCTTACTTTAAGGCAAGCATAGGCAAGCATCGTTTGCCAACTGTTATCGTTTGCCAACTGTTTTGCGGAAGTTTTGCGGAAGATTCATAGCCTATATTCATAGCCTATGTTCAATTCATAAAATGCACTGTAAAATCGCGGTAAA

Full Affymetrix probeset data:

Annotations for 1630286_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720