FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630287_at:

>probe:Drosophila_2:1630287_at:288:613; Interrogation_Position=195; Antisense; TGAAAAATGTCAACACCCGCACGCA
>probe:Drosophila_2:1630287_at:26:709; Interrogation_Position=247; Antisense; TTCAAGAGGATCCACCTACGGGTGT
>probe:Drosophila_2:1630287_at:276:497; Interrogation_Position=270; Antisense; GTCTCGGGTGCTCCAACAGATAATA
>probe:Drosophila_2:1630287_at:436:511; Interrogation_Position=315; Antisense; GTGATTTTTGGTCCACACGACACAC
>probe:Drosophila_2:1630287_at:458:397; Interrogation_Position=333; Antisense; GACACACCCTTCGAAGACGGAACAT
>probe:Drosophila_2:1630287_at:277:133; Interrogation_Position=398; Antisense; ACCGCCAACGGTTCGATTTGTATCG
>probe:Drosophila_2:1630287_at:174:589; Interrogation_Position=486; Antisense; TGGAGTCCCACGTACGATGTGTCAG
>probe:Drosophila_2:1630287_at:144:31; Interrogation_Position=525; Antisense; ATACAGTCACTGCTGAGCGATCCCA
>probe:Drosophila_2:1630287_at:163:133; Interrogation_Position=573; Antisense; ACCGCCGCCCAGCTGTATAAAGAAA
>probe:Drosophila_2:1630287_at:268:207; Interrogation_Position=615; Antisense; AAGCGTGTGAAAGCCTGCGTTGAGC
>probe:Drosophila_2:1630287_at:624:429; Interrogation_Position=641; Antisense; GAGTTTCATCGATTAGCCATGCGCC
>probe:Drosophila_2:1630287_at:90:323; Interrogation_Position=661; Antisense; GCGCCCACTTTAGGAACAGCAGCAG
>probe:Drosophila_2:1630287_at:722:567; Interrogation_Position=714; Antisense; GGCAGCAGTTTAGTAGGCGACCGCA
>probe:Drosophila_2:1630287_at:311:485; Interrogation_Position=726; Antisense; GTAGGCGACCGCAGCTTAAAGCATC

Paste this into a BLAST search page for me
TGAAAAATGTCAACACCCGCACGCATTCAAGAGGATCCACCTACGGGTGTGTCTCGGGTGCTCCAACAGATAATAGTGATTTTTGGTCCACACGACACACGACACACCCTTCGAAGACGGAACATACCGCCAACGGTTCGATTTGTATCGTGGAGTCCCACGTACGATGTGTCAGATACAGTCACTGCTGAGCGATCCCAACCGCCGCCCAGCTGTATAAAGAAAAAGCGTGTGAAAGCCTGCGTTGAGCGAGTTTCATCGATTAGCCATGCGCCGCGCCCACTTTAGGAACAGCAGCAGGGCAGCAGTTTAGTAGGCGACCGCAGTAGGCGACCGCAGCTTAAAGCATC

Full Affymetrix probeset data:

Annotations for 1630287_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720