FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630289_at:

>probe:Drosophila_2:1630289_at:480:661; Interrogation_Position=104; Antisense; TAACTTTGCCCACAGATACAGCTCT
>probe:Drosophila_2:1630289_at:117:629; Interrogation_Position=126; Antisense; TCTCTCCGAAGACGCTTTTACGAAC
>probe:Drosophila_2:1630289_at:494:607; Interrogation_Position=14; Antisense; TGAGTGGCTGCAATGCATCCGCAAT
>probe:Drosophila_2:1630289_at:566:705; Interrogation_Position=143; Antisense; TTACGAACTGCGTTAATCAGCCCCA
>probe:Drosophila_2:1630289_at:490:711; Interrogation_Position=155; Antisense; TTAATCAGCCCCACTGTGCAGCGAA
>probe:Drosophila_2:1630289_at:251:597; Interrogation_Position=169; Antisense; TGTGCAGCGAACACGGTGCAGAATT
>probe:Drosophila_2:1630289_at:249:425; Interrogation_Position=224; Antisense; GAGACGAGCACATCGATTGCCTGGA
>probe:Drosophila_2:1630289_at:248:9; Interrogation_Position=239; Antisense; ATTGCCTGGATTTCGGAGCACTCCA
>probe:Drosophila_2:1630289_at:366:259; Interrogation_Position=257; Antisense; CACTCCACAAACTGGGCAATCTGAA
>probe:Drosophila_2:1630289_at:89:373; Interrogation_Position=279; Antisense; GAAGTGCCAGGAAGAGTTGCCCTAC
>probe:Drosophila_2:1630289_at:608:93; Interrogation_Position=293; Antisense; AGTTGCCCTACATCTTTGCCAAAGT
>probe:Drosophila_2:1630289_at:370:237; Interrogation_Position=322; Antisense; AATCGATGTCTGAAATCCAAGGAGC
>probe:Drosophila_2:1630289_at:648:519; Interrogation_Position=50; Antisense; GGGCCTGCGGTATATTCCGAATCAC
>probe:Drosophila_2:1630289_at:465:517; Interrogation_Position=88; Antisense; GTGGAGGCGGGCAAACTAACTTTGC

Paste this into a BLAST search page for me
TAACTTTGCCCACAGATACAGCTCTTCTCTCCGAAGACGCTTTTACGAACTGAGTGGCTGCAATGCATCCGCAATTTACGAACTGCGTTAATCAGCCCCATTAATCAGCCCCACTGTGCAGCGAATGTGCAGCGAACACGGTGCAGAATTGAGACGAGCACATCGATTGCCTGGAATTGCCTGGATTTCGGAGCACTCCACACTCCACAAACTGGGCAATCTGAAGAAGTGCCAGGAAGAGTTGCCCTACAGTTGCCCTACATCTTTGCCAAAGTAATCGATGTCTGAAATCCAAGGAGCGGGCCTGCGGTATATTCCGAATCACGTGGAGGCGGGCAAACTAACTTTGC

Full Affymetrix probeset data:

Annotations for 1630289_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720