FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630291_at:

>probe:Drosophila_2:1630291_at:383:627; Interrogation_Position=109; Antisense; TGCCAGTGCTCGGCCCAAAAGTGCG
>probe:Drosophila_2:1630291_at:681:193; Interrogation_Position=139; Antisense; AACTGCGCCTGCAACAAGGATTGCC
>probe:Drosophila_2:1630291_at:164:187; Interrogation_Position=151; Antisense; AACAAGGATTGCCAGTGCGTTTGCA
>probe:Drosophila_2:1630291_at:81:509; Interrogation_Position=165; Antisense; GTGCGTTTGCAAGAATGGGCCCAAG
>probe:Drosophila_2:1630291_at:213:467; Interrogation_Position=169; Antisense; GTTTGCAAGAATGGGCCCAAGGACC
>probe:Drosophila_2:1630291_at:503:251; Interrogation_Position=186; Antisense; CAAGGACCAGTGCTGCAGCAACAAA
>probe:Drosophila_2:1630291_at:290:111; Interrogation_Position=202; Antisense; AGCAACAAATAAGCGGGCCAACTAT
>probe:Drosophila_2:1630291_at:457:329; Interrogation_Position=214; Antisense; GCGGGCCAACTATATAACTAACTGT
>probe:Drosophila_2:1630291_at:295:641; Interrogation_Position=239; Antisense; TTAACTTCTAAACTGGAGCTTAACT
>probe:Drosophila_2:1630291_at:607:585; Interrogation_Position=252; Antisense; TGGAGCTTAACTCCCAACGAGTTGG
>probe:Drosophila_2:1630291_at:251:221; Interrogation_Position=26; Antisense; AAGTGAATATCAGTTCGCCTCAGCC
>probe:Drosophila_2:1630291_at:255:631; Interrogation_Position=263; Antisense; TCCCAACGAGTTGGCCGCAATAAAT
>probe:Drosophila_2:1630291_at:415:471; Interrogation_Position=38; Antisense; GTTCGCCTCAGCCAAGTGAAAGTCG
>probe:Drosophila_2:1630291_at:287:145; Interrogation_Position=73; Antisense; ACATACAAGATGGTTTGCAAGGGTT

Paste this into a BLAST search page for me
TGCCAGTGCTCGGCCCAAAAGTGCGAACTGCGCCTGCAACAAGGATTGCCAACAAGGATTGCCAGTGCGTTTGCAGTGCGTTTGCAAGAATGGGCCCAAGGTTTGCAAGAATGGGCCCAAGGACCCAAGGACCAGTGCTGCAGCAACAAAAGCAACAAATAAGCGGGCCAACTATGCGGGCCAACTATATAACTAACTGTTTAACTTCTAAACTGGAGCTTAACTTGGAGCTTAACTCCCAACGAGTTGGAAGTGAATATCAGTTCGCCTCAGCCTCCCAACGAGTTGGCCGCAATAAATGTTCGCCTCAGCCAAGTGAAAGTCGACATACAAGATGGTTTGCAAGGGTT

Full Affymetrix probeset data:

Annotations for 1630291_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720