FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630293_at:

>probe:Drosophila_2:1630293_at:715:259; Interrogation_Position=1081; Antisense; CACGCCGCCCCAGAAAATGATTTAT
>probe:Drosophila_2:1630293_at:170:17; Interrogation_Position=1100; Antisense; ATTTATGGTGCGCTGTTGGACATGC
>probe:Drosophila_2:1630293_at:324:501; Interrogation_Position=1125; Antisense; GTCGGGATCTGTGCTCGTTGATACA
>probe:Drosophila_2:1630293_at:466:117; Interrogation_Position=1233; Antisense; AGCTCCGCGTGTTGCCTAAGGGTGT
>probe:Drosophila_2:1630293_at:102:279; Interrogation_Position=1248; Antisense; CTAAGGGTGTCAGCAGTGCAGCCGA
>probe:Drosophila_2:1630293_at:98:467; Interrogation_Position=1282; Antisense; GTTGGCTCGCAAGTACAACTGCTCC
>probe:Drosophila_2:1630293_at:346:197; Interrogation_Position=1385; Antisense; AACGTGATGTCGCTGCGGCTGTCAA
>probe:Drosophila_2:1630293_at:319:573; Interrogation_Position=1401; Antisense; GGCTGTCAATCTCTATTCCCGATGA
>probe:Drosophila_2:1630293_at:29:525; Interrogation_Position=1453; Antisense; GGGCATTCTTTGTCAGCTTGGCGAC
>probe:Drosophila_2:1630293_at:352:617; Interrogation_Position=1482; Antisense; TGCACGTCCGGGATGATTACTCCGT
>probe:Drosophila_2:1630293_at:452:457; Interrogation_Position=1496; Antisense; GATTACTCCGTGGATCTACTTACCG
>probe:Drosophila_2:1630293_at:23:263; Interrogation_Position=1531; Antisense; CAGCGAGCCCCAGGACATAGAAGTC
>probe:Drosophila_2:1630293_at:706:109; Interrogation_Position=1549; Antisense; AGAAGTCTGTCTACCTGCAAGCCGA
>probe:Drosophila_2:1630293_at:424:393; Interrogation_Position=1629; Antisense; GACAATTGCAAAGCCACGGTGACGG

Paste this into a BLAST search page for me
CACGCCGCCCCAGAAAATGATTTATATTTATGGTGCGCTGTTGGACATGCGTCGGGATCTGTGCTCGTTGATACAAGCTCCGCGTGTTGCCTAAGGGTGTCTAAGGGTGTCAGCAGTGCAGCCGAGTTGGCTCGCAAGTACAACTGCTCCAACGTGATGTCGCTGCGGCTGTCAAGGCTGTCAATCTCTATTCCCGATGAGGGCATTCTTTGTCAGCTTGGCGACTGCACGTCCGGGATGATTACTCCGTGATTACTCCGTGGATCTACTTACCGCAGCGAGCCCCAGGACATAGAAGTCAGAAGTCTGTCTACCTGCAAGCCGAGACAATTGCAAAGCCACGGTGACGG

Full Affymetrix probeset data:

Annotations for 1630293_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720