FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630298_at:

>probe:Drosophila_2:1630298_at:579:403; Interrogation_Position=1463; Antisense; GACTAATGGGCTACCTCGGAGGGAT
>probe:Drosophila_2:1630298_at:618:191; Interrogation_Position=1520; Antisense; AATCTGGTCCCATGCCGGAAGTTTA
>probe:Drosophila_2:1630298_at:715:207; Interrogation_Position=1552; Antisense; AAGCTCTTCCGCGAGATGTTGCTGC
>probe:Drosophila_2:1630298_at:212:595; Interrogation_Position=1585; Antisense; TGTGTGCTGCCCCATGACGTGAAAT
>probe:Drosophila_2:1630298_at:60:141; Interrogation_Position=1601; Antisense; ACGTGAAATCCGATCTTCTTCTGCA
>probe:Drosophila_2:1630298_at:421:45; Interrogation_Position=1631; Antisense; ATCGCCTGTGTCATGCTCTGAATAT
>probe:Drosophila_2:1630298_at:488:241; Interrogation_Position=1651; Antisense; AATATCCTACGCTACTTTGCGGCAA
>probe:Drosophila_2:1630298_at:311:73; Interrogation_Position=1727; Antisense; AGGAATTGCTGGACCCACTGGGAAC
>probe:Drosophila_2:1630298_at:20:125; Interrogation_Position=1752; Antisense; AGCGCTTAACTTTTCGATGGCCCAT
>probe:Drosophila_2:1630298_at:655:549; Interrogation_Position=1899; Antisense; GGAGAGCAAGCTGCCCGACATTGGA
>probe:Drosophila_2:1630298_at:137:109; Interrogation_Position=1931; Antisense; AGAAGCTCGATGTGCTGGCCAGTTC
>probe:Drosophila_2:1630298_at:388:665; Interrogation_Position=1976; Antisense; TACAATCTTTATATCTGCGCGCCAG
>probe:Drosophila_2:1630298_at:29:427; Interrogation_Position=2000; Antisense; GAGAGATCATCGAACAGTCCGCTCG
>probe:Drosophila_2:1630298_at:579:529; Interrogation_Position=2033; Antisense; GGGTTGCCAATCCATCAGATGCTTA

Paste this into a BLAST search page for me
GACTAATGGGCTACCTCGGAGGGATAATCTGGTCCCATGCCGGAAGTTTAAAGCTCTTCCGCGAGATGTTGCTGCTGTGTGCTGCCCCATGACGTGAAATACGTGAAATCCGATCTTCTTCTGCAATCGCCTGTGTCATGCTCTGAATATAATATCCTACGCTACTTTGCGGCAAAGGAATTGCTGGACCCACTGGGAACAGCGCTTAACTTTTCGATGGCCCATGGAGAGCAAGCTGCCCGACATTGGAAGAAGCTCGATGTGCTGGCCAGTTCTACAATCTTTATATCTGCGCGCCAGGAGAGATCATCGAACAGTCCGCTCGGGGTTGCCAATCCATCAGATGCTTA

Full Affymetrix probeset data:

Annotations for 1630298_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720