FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630299_at:

>probe:Drosophila_2:1630299_at:331:565; Interrogation_Position=196; Antisense; GGCAATTGTCTGGAATTCTCCGTAC
>probe:Drosophila_2:1630299_at:102:651; Interrogation_Position=266; Antisense; TCACCCAAGCTCCTGTTGAAACTTG
>probe:Drosophila_2:1630299_at:600:395; Interrogation_Position=303; Antisense; GACAATGGTTCACCAAACTCGCACA
>probe:Drosophila_2:1630299_at:528:169; Interrogation_Position=390; Antisense; AAAGTACGCCGTTTCGAGCAGTCCG
>probe:Drosophila_2:1630299_at:72:575; Interrogation_Position=414; Antisense; GGCGGATAGTTTCCTGCGGAACACC
>probe:Drosophila_2:1630299_at:167:561; Interrogation_Position=431; Antisense; GGAACACCAGGCTCACGGCTCAGAG
>probe:Drosophila_2:1630299_at:124:641; Interrogation_Position=469; Antisense; TCGGCCGCCTTCAAATACAATCAGA
>probe:Drosophila_2:1630299_at:50:441; Interrogation_Position=492; Antisense; GATGGTCACCCACAATCGGGAGCAG
>probe:Drosophila_2:1630299_at:145:93; Interrogation_Position=515; Antisense; AGTTCAATAACCTGCACTTCTGCTA
>probe:Drosophila_2:1630299_at:281:139; Interrogation_Position=564; Antisense; ACGTCGTCGCTGGAGAGACCGCATT
>probe:Drosophila_2:1630299_at:556:529; Interrogation_Position=595; Antisense; GGGATATACCACTACTCGTACGATG
>probe:Drosophila_2:1630299_at:390:409; Interrogation_Position=619; Antisense; GACGATTGCTTGTCACCATACTTAA
>probe:Drosophila_2:1630299_at:20:665; Interrogation_Position=693; Antisense; TAAATCGCAGTAGTCACGTGCTGGG
>probe:Drosophila_2:1630299_at:392:665; Interrogation_Position=761; Antisense; TAAATTACCCCAACTAAGCCTGCGA

Paste this into a BLAST search page for me
GGCAATTGTCTGGAATTCTCCGTACTCACCCAAGCTCCTGTTGAAACTTGGACAATGGTTCACCAAACTCGCACAAAAGTACGCCGTTTCGAGCAGTCCGGGCGGATAGTTTCCTGCGGAACACCGGAACACCAGGCTCACGGCTCAGAGTCGGCCGCCTTCAAATACAATCAGAGATGGTCACCCACAATCGGGAGCAGAGTTCAATAACCTGCACTTCTGCTAACGTCGTCGCTGGAGAGACCGCATTGGGATATACCACTACTCGTACGATGGACGATTGCTTGTCACCATACTTAATAAATCGCAGTAGTCACGTGCTGGGTAAATTACCCCAACTAAGCCTGCGA

Full Affymetrix probeset data:

Annotations for 1630299_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720