FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630300_at:

>probe:Drosophila_2:1630300_at:546:399; Interrogation_Position=1989; Antisense; GACAGGCAGTTTTGACGCCGTACCA
>probe:Drosophila_2:1630300_at:8:673; Interrogation_Position=2009; Antisense; TACCAGCGGTGGCACGCGATTACAA
>probe:Drosophila_2:1630300_at:98:385; Interrogation_Position=2070; Antisense; GAACTACGGCGAGGGATCATCCAGG
>probe:Drosophila_2:1630300_at:386:583; Interrogation_Position=2108; Antisense; TGGAACCTCGACACTTGGGCGGAGT
>probe:Drosophila_2:1630300_at:245:389; Interrogation_Position=2181; Antisense; GAAACAGGGTATGCTCGCCCTGACA
>probe:Drosophila_2:1630300_at:607:309; Interrogation_Position=2209; Antisense; GCCAATCCCGGTGACTACGACAAAG
>probe:Drosophila_2:1630300_at:620:171; Interrogation_Position=2230; Antisense; AAAGTTCAGCCGTCGAGCAAGATTT
>probe:Drosophila_2:1630300_at:234:361; Interrogation_Position=2246; Antisense; GCAAGATTTCGATACTGAACCTCAA
>probe:Drosophila_2:1630300_at:441:613; Interrogation_Position=2261; Antisense; TGAACCTCAAGGACTTGGCACCTGG
>probe:Drosophila_2:1630300_at:491:131; Interrogation_Position=2280; Antisense; ACCTGGCAAGCCTGTGGATGCTGAG
>probe:Drosophila_2:1630300_at:435:533; Interrogation_Position=2317; Antisense; GGTAGCTCCGACAAAATCCAGTTGA
>probe:Drosophila_2:1630300_at:168:95; Interrogation_Position=2336; Antisense; AGTTGAACCACACCCTTAATGAGCT
>probe:Drosophila_2:1630300_at:73:57; Interrogation_Position=2354; Antisense; ATGAGCTGCAGATCCAGTGGTTCCA
>probe:Drosophila_2:1630300_at:620:37; Interrogation_Position=2396; Antisense; ATCTAATGAAGGAGCTTGCCGCCAA

Paste this into a BLAST search page for me
GACAGGCAGTTTTGACGCCGTACCATACCAGCGGTGGCACGCGATTACAAGAACTACGGCGAGGGATCATCCAGGTGGAACCTCGACACTTGGGCGGAGTGAAACAGGGTATGCTCGCCCTGACAGCCAATCCCGGTGACTACGACAAAGAAAGTTCAGCCGTCGAGCAAGATTTGCAAGATTTCGATACTGAACCTCAATGAACCTCAAGGACTTGGCACCTGGACCTGGCAAGCCTGTGGATGCTGAGGGTAGCTCCGACAAAATCCAGTTGAAGTTGAACCACACCCTTAATGAGCTATGAGCTGCAGATCCAGTGGTTCCAATCTAATGAAGGAGCTTGCCGCCAA

Full Affymetrix probeset data:

Annotations for 1630300_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720