FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630301_at:

>probe:Drosophila_2:1630301_at:240:535; Interrogation_Position=1020; Antisense; GGTGCCGCTTCCATTGGCAGCGAAA
>probe:Drosophila_2:1630301_at:337:315; Interrogation_Position=1051; Antisense; GCCATTACATGGTGCTGTGGTCATT
>probe:Drosophila_2:1630301_at:434:595; Interrogation_Position=1066; Antisense; TGTGGTCATTTGAGTCCAGCCGACT
>probe:Drosophila_2:1630301_at:706:261; Interrogation_Position=1082; Antisense; CAGCCGACTGTTTATTTGGGTACTC
>probe:Drosophila_2:1630301_at:725:567; Interrogation_Position=588; Antisense; GGCATCATAAGCAAGTCGACCGACA
>probe:Drosophila_2:1630301_at:222:133; Interrogation_Position=618; Antisense; ACCGCGGACGGTATGTTGAGCAATC
>probe:Drosophila_2:1630301_at:388:197; Interrogation_Position=658; Antisense; AACGGAGCGGCAACAGGATCACAAG
>probe:Drosophila_2:1630301_at:475:121; Interrogation_Position=700; Antisense; AGCGGAGCGGTTTCAGGAGCACCAA
>probe:Drosophila_2:1630301_at:193:155; Interrogation_Position=771; Antisense; ACAGAGGGCGGCATAACGACCAAAT
>probe:Drosophila_2:1630301_at:165:213; Interrogation_Position=834; Antisense; AAGAGCATCGGGACTGGCGCAACGA
>probe:Drosophila_2:1630301_at:531:295; Interrogation_Position=856; Antisense; CGAGCGCAGAGATTGGTACCAGCAT
>probe:Drosophila_2:1630301_at:469:101; Interrogation_Position=897; Antisense; AGAGAAGCCGCAGTCCGAGCAGGCA
>probe:Drosophila_2:1630301_at:696:503; Interrogation_Position=909; Antisense; GTCCGAGCAGGCATCGACATGGCGA
>probe:Drosophila_2:1630301_at:556:415; Interrogation_Position=953; Antisense; GAGCCACGCGAGAAGCAGCACAATA

Paste this into a BLAST search page for me
GGTGCCGCTTCCATTGGCAGCGAAAGCCATTACATGGTGCTGTGGTCATTTGTGGTCATTTGAGTCCAGCCGACTCAGCCGACTGTTTATTTGGGTACTCGGCATCATAAGCAAGTCGACCGACAACCGCGGACGGTATGTTGAGCAATCAACGGAGCGGCAACAGGATCACAAGAGCGGAGCGGTTTCAGGAGCACCAAACAGAGGGCGGCATAACGACCAAATAAGAGCATCGGGACTGGCGCAACGACGAGCGCAGAGATTGGTACCAGCATAGAGAAGCCGCAGTCCGAGCAGGCAGTCCGAGCAGGCATCGACATGGCGAGAGCCACGCGAGAAGCAGCACAATA

Full Affymetrix probeset data:

Annotations for 1630301_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720