Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630302_at:

>probe:Drosophila_2:1630302_at:56:65; Interrogation_Position=1056; Antisense; ATGGACGTCCGATCTGCCCGAGAAT
>probe:Drosophila_2:1630302_at:167:675; Interrogation_Position=1100; Antisense; TAGCCCGCACTGGAGCTGAGGCCAT
>probe:Drosophila_2:1630302_at:50:423; Interrogation_Position=1126; Antisense; GAGAACGCCACTGGTACGGTGTACA
>probe:Drosophila_2:1630302_at:94:141; Interrogation_Position=1141; Antisense; ACGGTGTACACCTATGGATCCTCCA
>probe:Drosophila_2:1630302_at:710:545; Interrogation_Position=1156; Antisense; GGATCCTCCACAAATGTCCTGTATA
>probe:Drosophila_2:1630302_at:713:503; Interrogation_Position=1171; Antisense; GTCCTGTATATTGCTGCTGGAGCCA
>probe:Drosophila_2:1630302_at:697:667; Interrogation_Position=1210; Antisense; TACTATGCCGGCTTCAATGTGTCCA
>probe:Drosophila_2:1630302_at:185:63; Interrogation_Position=1226; Antisense; ATGTGTCCATCACCATGGAGTTGCC
>probe:Drosophila_2:1630302_at:431:535; Interrogation_Position=1252; Antisense; GGTGCTGGCTCCATTGGATTCAATC
>probe:Drosophila_2:1630302_at:631:629; Interrogation_Position=1278; Antisense; TCCAGTCACCCGAATCGATGAGTTT
>probe:Drosophila_2:1630302_at:261:691; Interrogation_Position=1300; Antisense; TTTGTCACCGAAACCTGGATTGGCA
>probe:Drosophila_2:1630302_at:459:583; Interrogation_Position=1320; Antisense; TGGCATCCGTGCCATGGCCGAGAAA
>probe:Drosophila_2:1630302_at:290:423; Interrogation_Position=955; Antisense; GAGACGATTACCGTCCGGGATCTGA
>probe:Drosophila_2:1630302_at:465:545; Interrogation_Position=972; Antisense; GGATCTGATGCACTCACTGGCCGAT

Paste this into a BLAST search page for me
ATGGACGTCCGATCTGCCCGAGAATTAGCCCGCACTGGAGCTGAGGCCATGAGAACGCCACTGGTACGGTGTACAACGGTGTACACCTATGGATCCTCCAGGATCCTCCACAAATGTCCTGTATAGTCCTGTATATTGCTGCTGGAGCCATACTATGCCGGCTTCAATGTGTCCAATGTGTCCATCACCATGGAGTTGCCGGTGCTGGCTCCATTGGATTCAATCTCCAGTCACCCGAATCGATGAGTTTTTTGTCACCGAAACCTGGATTGGCATGGCATCCGTGCCATGGCCGAGAAAGAGACGATTACCGTCCGGGATCTGAGGATCTGATGCACTCACTGGCCGAT

Full Affymetrix probeset data:

Annotations for 1630302_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime