Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630304_at:

>probe:Drosophila_2:1630304_at:592:143; Interrogation_Position=12927; Antisense; ACTGTTTTTGGATCAAGTGCCGCCC
>probe:Drosophila_2:1630304_at:550:219; Interrogation_Position=12941; Antisense; AAGTGCCGCCCATTTGGACGCAACG
>probe:Drosophila_2:1630304_at:672:717; Interrogation_Position=12975; Antisense; TTCGCTCTTGGGTCTCAACAACTGG
>probe:Drosophila_2:1630304_at:49:161; Interrogation_Position=12992; Antisense; ACAACTGGTTCATCGATCTGTGCCT
>probe:Drosophila_2:1630304_at:161:401; Interrogation_Position=13035; Antisense; GACATGGTCCACTGATTTTGTACTA
>probe:Drosophila_2:1630304_at:587:499; Interrogation_Position=13069; Antisense; GTCTGGCTGGCTGGGTTCTTTAATC
>probe:Drosophila_2:1630304_at:466:645; Interrogation_Position=13115; Antisense; TCATGCAGAGCACCGCCCGTAGAAA
>probe:Drosophila_2:1630304_at:344:215; Interrogation_Position=13156; Antisense; AAGATGTGCCTCCAGTGTGACGTGA
>probe:Drosophila_2:1630304_at:134:499; Interrogation_Position=13194; Antisense; GGAGGAATTTACGACGGCACCGCGC
>probe:Drosophila_2:1630304_at:645:335; Interrogation_Position=13223; Antisense; GCTGCTGCGTGCATGGGATCTTCAT
>probe:Drosophila_2:1630304_at:233:483; Interrogation_Position=13277; Antisense; GTATCATCATGGAGTCGCGCCTCAA
>probe:Drosophila_2:1630304_at:568:541; Interrogation_Position=13367; Antisense; GGAACATGTACGAGTGCCCGGTCTA
>probe:Drosophila_2:1630304_at:68:359; Interrogation_Position=13460; Antisense; GCAAATGGATCCTGGCCGGCGTAGC
>probe:Drosophila_2:1630304_at:46:291; Interrogation_Position=13479; Antisense; CGTAGCGCTGCTCTTGCAAACCTAA

Paste this into a BLAST search page for me
ACTGTTTTTGGATCAAGTGCCGCCCAAGTGCCGCCCATTTGGACGCAACGTTCGCTCTTGGGTCTCAACAACTGGACAACTGGTTCATCGATCTGTGCCTGACATGGTCCACTGATTTTGTACTAGTCTGGCTGGCTGGGTTCTTTAATCTCATGCAGAGCACCGCCCGTAGAAAAAGATGTGCCTCCAGTGTGACGTGAGGAGGAATTTACGACGGCACCGCGCGCTGCTGCGTGCATGGGATCTTCATGTATCATCATGGAGTCGCGCCTCAAGGAACATGTACGAGTGCCCGGTCTAGCAAATGGATCCTGGCCGGCGTAGCCGTAGCGCTGCTCTTGCAAACCTAA

Full Affymetrix probeset data:

Annotations for 1630304_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime