Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630305_at:

>probe:Drosophila_2:1630305_at:479:617; Interrogation_Position=2685; Antisense; TGCAGTGGCGGTGGCTTTTAGCACC
>probe:Drosophila_2:1630305_at:238:347; Interrogation_Position=2733; Antisense; GCATCCTCATCCTTTGAGCACGTGA
>probe:Drosophila_2:1630305_at:526:609; Interrogation_Position=2747; Antisense; TGAGCACGTGAGTCTTGGGCCGCAA
>probe:Drosophila_2:1630305_at:61:303; Interrogation_Position=2766; Antisense; CCGCAACTCGCACTTGTACATATAG
>probe:Drosophila_2:1630305_at:292:427; Interrogation_Position=2790; Antisense; GAGATACCTATGAAGAGCCGATCGA
>probe:Drosophila_2:1630305_at:290:213; Interrogation_Position=2802; Antisense; AAGAGCCGATCGAGAGCGCTGCCTT
>probe:Drosophila_2:1630305_at:250:103; Interrogation_Position=2814; Antisense; AGAGCGCTGCCTTTTGTGTTGTTCA
>probe:Drosophila_2:1630305_at:349:513; Interrogation_Position=2829; Antisense; GTGTTGTTCAGTTCCAGTACTATAT
>probe:Drosophila_2:1630305_at:330:677; Interrogation_Position=2858; Antisense; TAGATTATATAGATTCTGTTCCGGG
>probe:Drosophila_2:1630305_at:679:131; Interrogation_Position=2928; Antisense; ACCGTGATGTAGTTGTAAGTGCAGC
>probe:Drosophila_2:1630305_at:408:85; Interrogation_Position=2945; Antisense; AGTGCAGCAGAACTTTTGTTAACAA
>probe:Drosophila_2:1630305_at:679:645; Interrogation_Position=3002; Antisense; TAATTCCGTGCCATTTGTTTTCGTT
>probe:Drosophila_2:1630305_at:658:529; Interrogation_Position=3134; Antisense; GGGATCGTGTGTAATGTTCTTTCAT
>probe:Drosophila_2:1630305_at:265:169; Interrogation_Position=3163; Antisense; CAAAGCCCCAAATGAAACAGTCCCA

Paste this into a BLAST search page for me
TGCAGTGGCGGTGGCTTTTAGCACCGCATCCTCATCCTTTGAGCACGTGATGAGCACGTGAGTCTTGGGCCGCAACCGCAACTCGCACTTGTACATATAGGAGATACCTATGAAGAGCCGATCGAAAGAGCCGATCGAGAGCGCTGCCTTAGAGCGCTGCCTTTTGTGTTGTTCAGTGTTGTTCAGTTCCAGTACTATATTAGATTATATAGATTCTGTTCCGGGACCGTGATGTAGTTGTAAGTGCAGCAGTGCAGCAGAACTTTTGTTAACAATAATTCCGTGCCATTTGTTTTCGTTGGGATCGTGTGTAATGTTCTTTCATCAAAGCCCCAAATGAAACAGTCCCA

Full Affymetrix probeset data:

Annotations for 1630305_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime