Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630306_at:

>probe:Drosophila_2:1630306_at:672:527; Interrogation_Position=423; Antisense; GGGACCATCAGCTTCTGCATGGTGA
>probe:Drosophila_2:1630306_at:497:215; Interrogation_Position=510; Antisense; AAGATCTGGCTGCTTGTGGGCTTCC
>probe:Drosophila_2:1630306_at:631:229; Interrogation_Position=536; Antisense; AATGGGTTTTGCCTCCATCATTGCC
>probe:Drosophila_2:1630306_at:68:647; Interrogation_Position=553; Antisense; TCATTGCCGCCATCTGGGTGATGAT
>probe:Drosophila_2:1630306_at:203:583; Interrogation_Position=617; Antisense; TGGCGTGGCTCTGCTGATGCAAAAC
>probe:Drosophila_2:1630306_at:402:53; Interrogation_Position=633; Antisense; ATGCAAAACGTCTTCATCCTGTTCG
>probe:Drosophila_2:1630306_at:137:47; Interrogation_Position=648; Antisense; ATCCTGTTCGCCAGTTTGGTCTACA
>probe:Drosophila_2:1630306_at:93:563; Interrogation_Position=734; Antisense; GGAACGCAGCTTTTAGTATCTAGAC
>probe:Drosophila_2:1630306_at:372:53; Interrogation_Position=793; Antisense; ATGCTTGAGGCCGAGGACACCATCA
>probe:Drosophila_2:1630306_at:350:183; Interrogation_Position=850; Antisense; AAAATGTCCAACTCTGCTACTGTTC
>probe:Drosophila_2:1630306_at:324:41; Interrogation_Position=887; Antisense; ATCGTCGAGTCTGTACGGATTTCCC
>probe:Drosophila_2:1630306_at:713:459; Interrogation_Position=904; Antisense; GATTTCCCTCACTATTTCCGACATT
>probe:Drosophila_2:1630306_at:147:403; Interrogation_Position=923; Antisense; GACATTCTGCCGCTTTGAATCGGAA
>probe:Drosophila_2:1630306_at:562:523; Interrogation_Position=950; Antisense; GGGCGCAGAGCAGGGCCAATAATCT

Paste this into a BLAST search page for me
GGGACCATCAGCTTCTGCATGGTGAAAGATCTGGCTGCTTGTGGGCTTCCAATGGGTTTTGCCTCCATCATTGCCTCATTGCCGCCATCTGGGTGATGATTGGCGTGGCTCTGCTGATGCAAAACATGCAAAACGTCTTCATCCTGTTCGATCCTGTTCGCCAGTTTGGTCTACAGGAACGCAGCTTTTAGTATCTAGACATGCTTGAGGCCGAGGACACCATCAAAAATGTCCAACTCTGCTACTGTTCATCGTCGAGTCTGTACGGATTTCCCGATTTCCCTCACTATTTCCGACATTGACATTCTGCCGCTTTGAATCGGAAGGGCGCAGAGCAGGGCCAATAATCT

Full Affymetrix probeset data:

Annotations for 1630306_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime