FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630307_at:

>probe:Drosophila_2:1630307_at:253:427; Interrogation_Position=490; Antisense; GAGATCGTGGATGCCCACCCACAGT
>probe:Drosophila_2:1630307_at:325:77; Interrogation_Position=536; Antisense; AGGATACGCTAACCGGTGACTCCAA
>probe:Drosophila_2:1630307_at:239:253; Interrogation_Position=558; Antisense; CAAGACCCAGGAGGAGACTCGTGAT
>probe:Drosophila_2:1630307_at:632:441; Interrogation_Position=580; Antisense; GATGGTGATGTCGTCCGTGGATCCT
>probe:Drosophila_2:1630307_at:495:519; Interrogation_Position=596; Antisense; GTGGATCCTACTCTCTGATCGAGCC
>probe:Drosophila_2:1630307_at:647:63; Interrogation_Position=623; Antisense; ATGGTTCCCGTCGTATTGTCAGCTA
>probe:Drosophila_2:1630307_at:539:481; Interrogation_Position=635; Antisense; GTATTGTCAGCTACTACGCCGACTC
>probe:Drosophila_2:1630307_at:203:669; Interrogation_Position=649; Antisense; TACGCCGACTCCATCAACGGTTTCA
>probe:Drosophila_2:1630307_at:556:77; Interrogation_Position=689; Antisense; AGGATGTGCCCGTGGCTGTTGCCCC
>probe:Drosophila_2:1630307_at:152:603; Interrogation_Position=705; Antisense; TGTTGCCCCAGTGGCTCCAGTTTTG
>probe:Drosophila_2:1630307_at:678:631; Interrogation_Position=807; Antisense; TCCCATCGTCGCCTAAGTAGAAGGA
>probe:Drosophila_2:1630307_at:564:609; Interrogation_Position=860; Antisense; TGACCGCAATTCGACAAAGGACTTT
>probe:Drosophila_2:1630307_at:665:73; Interrogation_Position=877; Antisense; AGGACTTTCATCTGTACATATTCGA
>probe:Drosophila_2:1630307_at:538:237; Interrogation_Position=904; Antisense; AATCATTGTCGAGCTATTGAATAAC

Paste this into a BLAST search page for me
GAGATCGTGGATGCCCACCCACAGTAGGATACGCTAACCGGTGACTCCAACAAGACCCAGGAGGAGACTCGTGATGATGGTGATGTCGTCCGTGGATCCTGTGGATCCTACTCTCTGATCGAGCCATGGTTCCCGTCGTATTGTCAGCTAGTATTGTCAGCTACTACGCCGACTCTACGCCGACTCCATCAACGGTTTCAAGGATGTGCCCGTGGCTGTTGCCCCTGTTGCCCCAGTGGCTCCAGTTTTGTCCCATCGTCGCCTAAGTAGAAGGATGACCGCAATTCGACAAAGGACTTTAGGACTTTCATCTGTACATATTCGAAATCATTGTCGAGCTATTGAATAAC

Full Affymetrix probeset data:

Annotations for 1630307_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720