Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630308_at:

>probe:Drosophila_2:1630308_at:366:375; Interrogation_Position=2305; Antisense; GAAGAGCCATTCACCAAGCGCGTGT
>probe:Drosophila_2:1630308_at:107:111; Interrogation_Position=2374; Antisense; AGAATTCTGGGCGTCTCCTATGGCA
>probe:Drosophila_2:1630308_at:354:681; Interrogation_Position=2392; Antisense; TATGGCACTCTGTATGGGCGTTACC
>probe:Drosophila_2:1630308_at:398:671; Interrogation_Position=2413; Antisense; TACCGCGAGGTCTATGGCTGCCTTA
>probe:Drosophila_2:1630308_at:625:709; Interrogation_Position=2435; Antisense; TTAAGCATCCTTACAGTGGCACCGC
>probe:Drosophila_2:1630308_at:437:99; Interrogation_Position=2492; Antisense; AGATGGGAGTTCAGCCTCGCTTCGA
>probe:Drosophila_2:1630308_at:408:175; Interrogation_Position=2561; Antisense; AAACCAATCCCTACTTGCAGAGCTG
>probe:Drosophila_2:1630308_at:400:641; Interrogation_Position=2603; Antisense; TCTGAGCGAGCTATGGACACGTCCG
>probe:Drosophila_2:1630308_at:602:459; Interrogation_Position=2630; Antisense; GATTTGAGGACCAACCAATGCCACA
>probe:Drosophila_2:1630308_at:258:107; Interrogation_Position=2671; Antisense; AGAAAAGCCTCAAACGTCGCCACAG
>probe:Drosophila_2:1630308_at:161:503; Interrogation_Position=2686; Antisense; GTCGCCACAGGCTGATCTAGGATTA
>probe:Drosophila_2:1630308_at:615:303; Interrogation_Position=2754; Antisense; CCTGAGTAATGCTTTCCTGAATCCT
>probe:Drosophila_2:1630308_at:723:367; Interrogation_Position=2772; Antisense; GAATCCTGAATTCCCACATTAATGT
>probe:Drosophila_2:1630308_at:560:13; Interrogation_Position=2789; Antisense; ATTAATGTGTTGTTCCCATCGGTGG

Paste this into a BLAST search page for me
GAAGAGCCATTCACCAAGCGCGTGTAGAATTCTGGGCGTCTCCTATGGCATATGGCACTCTGTATGGGCGTTACCTACCGCGAGGTCTATGGCTGCCTTATTAAGCATCCTTACAGTGGCACCGCAGATGGGAGTTCAGCCTCGCTTCGAAAACCAATCCCTACTTGCAGAGCTGTCTGAGCGAGCTATGGACACGTCCGGATTTGAGGACCAACCAATGCCACAAGAAAAGCCTCAAACGTCGCCACAGGTCGCCACAGGCTGATCTAGGATTACCTGAGTAATGCTTTCCTGAATCCTGAATCCTGAATTCCCACATTAATGTATTAATGTGTTGTTCCCATCGGTGG

Full Affymetrix probeset data:

Annotations for 1630308_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime