Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630310_at:

>probe:Drosophila_2:1630310_at:300:111; Interrogation_Position=1051; Antisense; AGAATCTGTGTCACGGTGGCTTCTG
>probe:Drosophila_2:1630310_at:611:727; Interrogation_Position=1076; Antisense; TTGTCACTTCGATCTGGCCTGGAGA
>probe:Drosophila_2:1630310_at:553:279; Interrogation_Position=1133; Antisense; CTACAGCTATCGAGTGGGCATCTAT
>probe:Drosophila_2:1630310_at:101:407; Interrogation_Position=1180; Antisense; GACTGGATGTCAACTATATTCGCAA
>probe:Drosophila_2:1630310_at:658:247; Interrogation_Position=1203; Antisense; AATTGTGGCGTATTCACCTGCTCTG
>probe:Drosophila_2:1630310_at:56:649; Interrogation_Position=1250; Antisense; TCAGCTGCTGCCTGACATTCAGAGG
>probe:Drosophila_2:1630310_at:446:13; Interrogation_Position=1266; Antisense; ATTCAGAGGCCGCTGGTGACTTTCA
>probe:Drosophila_2:1630310_at:658:511; Interrogation_Position=1281; Antisense; GTGACTTTCACCCATGTGGAGATTA
>probe:Drosophila_2:1630310_at:354:459; Interrogation_Position=1301; Antisense; GATTAGGGTCACATATCCGCAGTCT
>probe:Drosophila_2:1630310_at:210:457; Interrogation_Position=1347; Antisense; GATACCCTGCTCGATAATCTTCTGC
>probe:Drosophila_2:1630310_at:560:83; Interrogation_Position=1393; Antisense; AGTGGTCACAAAAACGGATCTCCGA
>probe:Drosophila_2:1630310_at:712:425; Interrogation_Position=1419; Antisense; GAGAGTCACCAAGTGCGTTTTGCAT
>probe:Drosophila_2:1630310_at:608:559; Interrogation_Position=1447; Antisense; GGAAATCCCTAGAGGTCAAGCACCT
>probe:Drosophila_2:1630310_at:232:113; Interrogation_Position=1465; Antisense; AGCACCTTTTGACCTTTGGCATTTA

Paste this into a BLAST search page for me
AGAATCTGTGTCACGGTGGCTTCTGTTGTCACTTCGATCTGGCCTGGAGACTACAGCTATCGAGTGGGCATCTATGACTGGATGTCAACTATATTCGCAAAATTGTGGCGTATTCACCTGCTCTGTCAGCTGCTGCCTGACATTCAGAGGATTCAGAGGCCGCTGGTGACTTTCAGTGACTTTCACCCATGTGGAGATTAGATTAGGGTCACATATCCGCAGTCTGATACCCTGCTCGATAATCTTCTGCAGTGGTCACAAAAACGGATCTCCGAGAGAGTCACCAAGTGCGTTTTGCATGGAAATCCCTAGAGGTCAAGCACCTAGCACCTTTTGACCTTTGGCATTTA

Full Affymetrix probeset data:

Annotations for 1630310_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime