FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630311_at:

>probe:Drosophila_2:1630311_at:348:63; Interrogation_Position=13; Antisense; ATGTGCTTCTTAGTGGCTCGAAAAA
>probe:Drosophila_2:1630311_at:541:51; Interrogation_Position=285; Antisense; ATGCGAGCGCGCTCACTTATCTATT
>probe:Drosophila_2:1630311_at:263:339; Interrogation_Position=295; Antisense; GCTCACTTATCTATTCAGGCACCAA
>probe:Drosophila_2:1630311_at:371:13; Interrogation_Position=307; Antisense; ATTCAGGCACCAAACATTCAGACAC
>probe:Drosophila_2:1630311_at:198:263; Interrogation_Position=325; Antisense; CAGACACCAAACATTCAGACACCAA
>probe:Drosophila_2:1630311_at:57:399; Interrogation_Position=342; Antisense; GACACCAAACAGTATTTCAGCCAAA
>probe:Drosophila_2:1630311_at:108:179; Interrogation_Position=35; Antisense; AAACATTCGATCTAGAGGACATACT
>probe:Drosophila_2:1630311_at:259:59; Interrogation_Position=366; Antisense; ATGTTCACTGATCAAACCTCTTCGG
>probe:Drosophila_2:1630311_at:689:633; Interrogation_Position=384; Antisense; TCTTCGGGCGGCACTTTTCAAGGCG
>probe:Drosophila_2:1630311_at:567:567; Interrogation_Position=393; Antisense; GGCACTTTTCAAGGCGTCTCGAGTT
>probe:Drosophila_2:1630311_at:330:499; Interrogation_Position=408; Antisense; GTCTCGAGTTCCTGTGTCCGAGTAA
>probe:Drosophila_2:1630311_at:526:557; Interrogation_Position=51; Antisense; GGACATACTGGATTACTGGATTGGC
>probe:Drosophila_2:1630311_at:286:287; Interrogation_Position=66; Antisense; CTGGATTGGCAATACCCTTTGTGAA
>probe:Drosophila_2:1630311_at:88:361; Interrogation_Position=74; Antisense; GCAATACCCTTTGTGAAGCTCCGTT

Paste this into a BLAST search page for me
ATGTGCTTCTTAGTGGCTCGAAAAAATGCGAGCGCGCTCACTTATCTATTGCTCACTTATCTATTCAGGCACCAAATTCAGGCACCAAACATTCAGACACCAGACACCAAACATTCAGACACCAAGACACCAAACAGTATTTCAGCCAAAAAACATTCGATCTAGAGGACATACTATGTTCACTGATCAAACCTCTTCGGTCTTCGGGCGGCACTTTTCAAGGCGGGCACTTTTCAAGGCGTCTCGAGTTGTCTCGAGTTCCTGTGTCCGAGTAAGGACATACTGGATTACTGGATTGGCCTGGATTGGCAATACCCTTTGTGAAGCAATACCCTTTGTGAAGCTCCGTT

Full Affymetrix probeset data:

Annotations for 1630311_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720